Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1045 bp · TkA01G627010|TK1151|cDNA
TTTGATTTGATTGTTTTGTATTCGTTTCGGTGGCTTTAAAAAAAAAATCTATATATACTACAAAAATATCAACGTTCCCAGGCATTTCCTACACGATAGTTTTCCCAGAAATTTCCGACGGAATGTTTTACCCTAAAATCACGTTGACTATGCCGATCGTTCCTTTGACTGCCGAGCTGCTTCGCCTAAATGTTTGACCTCCCAAATGACAGTGATAAACAGACTCTCTAACACGAGCATCGCTCCTTCCAGCCCCGAAA...
459 bp · TkA01G627010|TK1151|CDS
ATGCGTGGTTTAGCAGCTAGATTCAGCTCCTATTTGTGCAGAAGAAGACCAGTGAATGTTCGATCACGCCAGTATTCGTCATCATATGAAAGAGGGTTTCCAGATGAACGAGAAATTGAAGAGGAAGCCGAAAGAAAATTCGGATGGCTCTTTAAACTCCTCTTTGTTGGAACTGCAACAATCGGGAGAATGTTTCAAGACCATCACCAACCACTGTCTTTCAAAGTGCAACTTCAGTACAGATGGATGACCAAGGTTAT...
Protein
Download Protein FASTA152 aa · TkA01G627010|TK1151|PROTEIN
MRGLAARFSSYLCRRRPVNVRSRQYSSSYERGFPDEREIEEEAERKFGWLFKLLFVGTATIGRMFQDHHQPLSFKVQLQYRWMTKVMFVSEKLVIGVGYDCNPMVFAVIGVGYELHSVCSGALKETNLLWEVELKLFVYVTMSKRITGGLVS
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G627010 |
|---|---|
| TK1151 ID | TkA01G627010 |
| OH-1004 ID | LXL04_017303 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 90.700 |
| Protein coverage (%) | TK1151 98.684 / OH-1004 38.743Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G627010 |
|---|---|
| Location | Chr01:158283009-158284954 (-) |
| Description | Similar to TFB2: General transcription and DNA repair factor IIH subunit TFB2 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006281 DNA repair Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006325 chromatin organization Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006468 protein phosphorylation Biological Process GO:0006974 DNA damage response Biological Process GO:0007623 circadian rhythm Biological Process GO:0009648 photoperiodism Biological Process GO:0009908 flower development Biological Process GO:0010225 response to UV-C Biological Process GO:0010229 inflorescence development Biological Process GO:0010332 response to gamma radiation Biological Process |
| KEGG gene cross-reference | ath:AT3G50000 ath:AT4G17020 ath:AT5G67380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.