TkA01G626770 | RubberDandelionOmics

Gene overview

TkA01G626770

Reference: TK1151 Chr: Chr01 Coordinates: 158197470-158200265 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1450 bp · TkA01G626770|TK1151|cDNA

AAATTGAGACTCACAAACAACGACACAAATATGATCATCATCATCTTCCTCTTCTTCATTAACCACATCCTCCTCCTATCATCTTCATCTACACCTTCACCGGCTCCTCCATGGCGGGCGGTGTTGCAACGGTGCAGCATAATCTCAAGATGCAGCCTTCTATCTCACTCCTCCCCTCTGCTCAATCCTCCTTCTGTGGCACTAAATTCAACACCTCCATCCAGTATAAAAGGAAAGTATGCCAAACAAAAGGAGCTTTG...

CDS

Download CDS FASTA

1152 bp · TkA01G626770|TK1151|CDS

ATGGCGGGCGGTGTTGCAACGGTGCAGCATAATCTCAAGATGCAGCCTTCTATCTCACTCCTCCCCTCTGCTCAATCCTCCTTCTGTGGCACTAAATTCAACACCTCCATCCAGTATAAAAGGAAAGTATGCCAAACAAAAGGAGCTTTGAACGTGGTAGCGTCAAGTGCCAAGAAAATTCTTGTAATGGGAGGCACACGTTTCATCGGGATCTTTCTTTCCAGGCTACTTGTCGAAGAGGGCCATCAGGTAACTTTGTT...

Protein

Download Protein FASTA

383 aa · TkA01G626770|TK1151|PROTEIN

MAGGVATVQHNLKMQPSISLLPSAQSSFCGTKFNTSIQYKRKVCQTKGALNVVASSAKKILVMGGTRFIGIFLSRLLVEEGHQVTLFTRGKAPITQPLPGEADEAYNSFKSKILHLKGDRKDFDFVKTSLAAEGFDVVYDINGREAVEVEPILDALPNLEQYIYCSSAGVYLKSDLLPHCETDAVDPKSRHKGKLETEALLESKGVNYTSIRPVYIYGPLNYNPVEEWFFHRLKAGRPIPIPNSGLQVTQLGHVKDLATA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G626770`
TK1151 ID	TkA01G626770
OH-1004 ID	LXL04_000238
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G626770

Location Chr01:158197470-158200265 (-)

Description Similar to CSP41B: Chloroplast stem-loop binding protein of 41 kDa b, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09340`	Binds and cleaves RNA, particularly in stem-loops.	ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings.2006 · DOI: 10.1007/s00425-006-0282-4 Arabidopsis thaliana mutants reveal a role for CSP41a and CSP41b, two ribosome-associated endonucleases, in chloroplast ribosomal RNA metabolism.2008 · DOI: 10.1007/s11103-008-9328-2 The RNA-binding proteins CSP41a and CSP41b may regulate transcription and translation of chloroplast-encoded RNAs in Arabidopsis.2009 · DOI: 10.1007/s11103-008-9436-z Identification of a novel heteroglycan-interacting protein, HIP 1.3, from Arabidopsis thaliana.2011 · DOI: 10.1016/j.jplph.2010.09.008 Plastid encoded RNA polymerase activity and expression of photosynthesis genes required for embryo and seed development in Arabidopsis.2014 · DOI: 10.3389/fpls.2014.00385
`At3g63140`	Binds and cleaves RNA, particularly in stem-loops.	Arabidopsis thaliana mutants reveal a role for CSP41a and CSP41b, two ribosome-associated endonucleases, in chloroplast ribosomal RNA metabolism.2008 · DOI: 10.1007/s11103-008-9328-2 The RNA-binding proteins CSP41a and CSP41b may regulate transcription and translation of chloroplast-encoded RNAs in Arabidopsis.2009 · DOI: 10.1007/s11103-008-9436-z
`At1g75280`	Isoflavone reductase homolog P3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000238 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005996 monosaccharide metabolic process Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009611 response to wounding Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009807 lignan biosynthetic process Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0032544 plastid translation Biological Process

GO:0033499 galactose catabolic process via UDP-galactose, Leloir pathway Biological Process

KEGG gene cross-reference

ath:AT1G09340

ath:AT1G75280

ath:AT3G63140

cgb:cg2104

cgl:Cgl1921

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.985

Rank 1 · TkA01G626770 · TK1151

Mitochondrion0.028

Rank 2 · TkA01G626770 · TK1151

Cytoplasm0.022

Rank 3 · TkA01G626770 · TK1151

Peroxisome0.018

Rank 4 · TkA01G626770 · TK1151

Cell membrane0.014

Rank 5 · TkA01G626770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368NmrA57-274 aa

PF00106adh_short58-127 aa

PF04321RmlD_sub_bind59-97 aa

PF01370Epimerase60-277 aa

PF16363GDP_Man_Dehyd61-149 aa

PF13460NAD_binding_1064-216 aa

PF04321RmlD_sub_bind163-299 aa

PF16363GDP_Man_Dehyd247-351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G626770	`PF05368`	NmrA	57	274	0.0012	19.2
TkA01G626770	`PF00106`	adh_short	58	127	0.048	13.9
TkA01G626770	`PF04321`	RmlD_sub_bind	59	97	0.00022	21.1
TkA01G626770	`PF01370`	Epimerase	60	277	3.3e-18	66.7
TkA01G626770	`PF16363`	GDP_Man_Dehyd	61	149	4.8e-07	30.3
TkA01G626770	`PF13460`	NAD_binding_10	64	216	4.8e-06	27.3
TkA01G626770	`PF04321`	RmlD_sub_bind	163	299	0.00022	21.1
TkA01G626770	`PF16363`	GDP_Man_Dehyd	247	351	4.8e-07	30.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA52`	Arabidopsis thaliana	sp\|Q9SA52\|CP41B_ARATH Chloroplast stem-loop binding protein of 41 kDa b, chloroplastic	80.900%	Swiss-Prot	High
`Q9LYA9`	Arabidopsis thaliana	sp\|Q9LYA9\|CP41A_ARATH Chloroplast stem-loop binding protein of 41 kDa a, chloroplastic	34.200%	Swiss-Prot	Medium
`P52577`	Arabidopsis thaliana	sp\|P52577\|IFRH_ARATH Isoflavone reductase homolog P3	26.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card