TkA01G625920 | RubberDandelionOmics

Gene overview

TkA01G625920

Reference: TK1151 Chr: Chr01 Coordinates: 158015643-158017975 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1710 bp · TkA01G625920|TK1151|cDNA

ATGAAATAGTTGTATCCGTAGGTAATTAACTCGTCTATGATGATAAGCACGCTTTCCTAGCCACCACAAAGACGAGGCAAACTGAAAAGAAACTCAAAGCTTCGTCCGACCATAGTCGCCGGAAAACTTTATTCTTACTCAGGGGAAGCAGTAGTTCTTCTAGGGCTTGGTTGATAAAACAGAACTGGGCGGCGTTTGTATGATATGTTGTACTTAGTGCGTGAGAACCTCTTCATCGGCAACATCAATGCAGCTGCAGA...

CDS

Download CDS FASTA

1158 bp · TkA01G625920|TK1151|CDS

ATGTTGTACTTAGTGCGTGAGAACCTCTTCATCGGCAACATCAATGCAGCTGCAGATGTACTTTTAAATGGCAGCGAAGAAATCACCCACATCTTATCAGTTCTGAGCTCGCCTTCCATAACCTTTTTCTCAGAATGGAAATCGACCTTTTCAGTTCCTACCAAAGAGATTCGCACGGTGTACACCGGGGATTCAGATTCAGATGAAATTTTGGATGGCGATGTGTCAGATAAATCCGCATTAACCTCCCAGAAGATTCA...

Protein

Download Protein FASTA

385 aa · TkA01G625920|TK1151|PROTEIN

MLYLVRENLFIGNINAAADVLLNGSEEITHILSVLSSPSITFFSEWKSTFSVPTKEIRTVYTGDSDSDEILDGDVSDKSALTSQKIHYVLENAGKDLKLVRMAVPLRDMESENLLDSLDVCLDFIDESRKKGGVLVHCFAGVSRSAAIITAYLMRTERLSLEDALESLRQSNESICPNDGFLEQLTMFEEMGFKVDHSTTLYKRFHLKVLGDSYNRGERMDTSKFAADPGMPKKETGMASQKEEKTPIPTSAFRCKKCRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G625920`
TK1151 ID	TkA01G625920
OH-1004 ID	LXL04_027336
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	53.200
Protein coverage (%)	TK1151 28.831 / OH-1004 86.290 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G625920

Location Chr01:158015643-158017975 (+)

Description Similar to At4g18593: Probable inactive dual specificity protein phosphatase-like At4g18593

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18593`	Probable inactive dual specificity protein phosphatase-like At4g18593.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027336 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0016311 dephosphorylation Biological Process

GO:0023052 signaling Biological Process

GO:0036211 protein modification process Biological Process

GO:0180023 cytosolic large ribosomal subunit assembly Biological Process

GO:1903301 positive regulation of hexokinase activity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004721 phosphoprotein phosphatase activity Molecular Function

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT4G18593

hsa:11266

mmu:80915

rno:64014

spo:2540146

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.547

Rank 1 · TkA01G625920 · TK1151

Nucleus0.365

Rank 2 · TkA01G625920 · TK1151

Mitochondrion0.096

Rank 3 · TkA01G625920 · TK1151

Cell membrane0.091

Rank 4 · TkA01G625920 · TK1151

Golgi apparatus0.078

Rank 5 · TkA01G625920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00782DSPc81-190 aa

PF22741PTP-NADK91-170 aa

PF22785Tc-R-P98-156 aa

PF22784PTP-SAK104-155 aa

PF04179Init_tRNA_PT109-156 aa

PF00102Y_phosphatase126-154 aa

PF03226Yippee-Mis18252-333 aa

PF00130C1_1252-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G625920	`PF00782`	DSPc	81	190	1.9e-26	93.2
TkA01G625920	`PF22741`	PTP-NADK	91	170	5e-05	23.5
TkA01G625920	`PF22785`	Tc-R-P	98	156	1.9e-07	32.3
TkA01G625920	`PF22784`	PTP-SAK	104	155	0.059	14.1
TkA01G625920	`PF04179`	Init_tRNA_PT	109	156	0.12	13.3
TkA01G625920	`PF00102`	Y_phosphatase	126	154	0.0057	17.0
TkA01G625920	`PF03226`	Yippee-Mis18	252	333	0.094	13.6
TkA01G625920	`PF00130`	C1_1	252	262	0.72	10.4
TkA01G625920	`PF23546`	Zn_ribbon_TOP3B	254	260	0.18	12.2
TkA01G625920	`PF23546`	Zn_ribbon_TOP3B	308	328	0.18	12.2
TkA01G625920	`PF00130`	C1_1	319	343	0.72	10.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q570P7`	Arabidopsis thaliana	sp\|Q570P7\|DUSL1_ARATH Probable inactive dual specificity protein phosphatase-like At4g18593	55.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card