Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2970 bp · TkA01G623350|TK1151|cDNA
TAAAAAACAAACAAACAAACAAACAAACAAACTTATAAAAAAAAATTCCAAACTAAAAAGCTTCTGCGAATTACCCAAATACCCTTGTCAATACCCATTGCCGCCTCAAACAGAAAACACATCGGCCAGAACACATCGCCACACACAGCGCTGAGAAATCGGACTCCTCCTCCTGTTGCAGCCACAGCCACCTTTTCCACCTCCGGCAGACCGGCACACACAGTTTGCCCTAAAAACAATGAACACCAGAATATGGTAAA...
2367 bp · TkA01G623350|TK1151|CDS
ATGAACGCAAAAATGAAAGCAAGAAACGCTACAGAAAACGGCGAAACAGCCGAAGATTCAATCCTCATGACATTAATAGGCAATGGTGAAGATCTAGCACCAATGGTAAGGCACTCATTCGAAATGGGAAAACCCGAAACCCTAGTCCACCAACTCAAACTCATTGTCAAAAAGAAAGAAATTGAAATCGAAGACCTCTGCAAACTCCACTACGAAGAATTCATAGTTGCAGTCGATGAGCTTCGCGGTGTCCTCGTTGA...
Protein
Download Protein FASTA788 aa · TkA01G623350|TK1151|PROTEIN
MNAKMKARNATENGETAEDSILMTLIGNGEDLAPMVRHSFEMGKPETLVHQLKLIVKKKEIEIEDLCKLHYEEFIVAVDELRGVLVDAEELKSELASDNFRLQEIGTALLTRLEDLLESFAIKQNVTEAVKMSRICVEVLDLCIKCNKHVADGQFYPALKAIHQIEESYMKVIPVKTLKNLVEKRVPVIKNHIEKKVCGEINEWLVHIRGTAKEIGQNAIGLASSSRQRNEDMLARQKKAEEESCLGLGDFTYSLDVEEI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G623350 |
|---|---|
| TK1151 ID | TkA01G623350 |
| OH-1004 ID | LXL04_000272 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G623350 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:157340655-157344284 (+) | |||||||||
| Description | Similar to SEC15A: Exocyst complex component SEC15A | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000281 mitotic cytokinesis Biological Process GO:0006886 intracellular protein transport Biological Process GO:0006887 exocytosis Biological Process GO:0006893 Golgi to plasma membrane transport Biological Process GO:0006904 vesicle docking involved in exocytosis Biological Process GO:0009846 pollen germination Biological Process GO:0009860 pollen tube growth Biological Process GO:0060321 acceptance of pollen Biological Process GO:0090148 membrane fission Biological Process GO:0090522 vesicle tethering involved in exocytosis Biological Process GO:0000145 exocyst Cellular Component GO:0005634 nucleus Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT3G56640 ath:AT4G02350 hsa:23233 hsa:54536 mmu:75914 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF10392COG5_N47-142 aaPF20651EXOC6_Sec15_N51-220 aaPF05816TelA77-129 aaPF28093STM3845162-214 aaPF24941DUF7757176-266 aaPF04091Sec15_C196-231 aaPF01843DIL361-380 aaPF10392COG5_N362-432 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G623350 | PF10392 | COG5_N | 47 | 142 | 3.0 | 8.8 |
| TkA01G623350 | PF20651 | EXOC6_Sec15_N | 51 | 220 | 2.3e-47 | 161.8 |
| TkA01G623350 | PF05816 | TelA | 77 | 129 | 0.34 | 10.7 |
| TkA01G623350 | PF28093 | STM3845 | 162 | 214 | 0.12 | 12.9 |
| TkA01G623350 | PF24941 | DUF7757 | 176 | 266 | 0.021 | 15.3 |
| TkA01G623350 | PF04091 | Sec15_C | 196 | 231 | 5.4e-93 | 312.8 |
| TkA01G623350 | PF01843 | DIL | 361 | 380 | 0.00099 | 20.0 |
| TkA01G623350 | PF10392 | COG5_N | 362 | 432 | 3.0 | 8.8 |
| TkA01G623350 | PF24941 | DUF7757 | 400 | 440 | 0.021 | 15.3 |
| TkA01G623350 | PF04091 | Sec15_C | 401 | 751 | 5.4e-93 | 312.8 |
| TkA01G623350 | PF22440 | SirC_C | 415 | 438 | 0.055 | 14.2 |
| TkA01G623350 | PF20651 | EXOC6_Sec15_N | 418 | 429 | 2.3e-47 | 161.8 |
| TkA01G623350 | PF01843 | DIL | 521 | 544 | 0.00099 | 20.0 |
| TkA01G623350 | PF05816 | TelA | 550 | 660 | 0.34 | 10.7 |
| TkA01G623350 | PF28093 | STM3845 | 585 | 606 | 0.12 | 12.9 |
| TkA01G623350 | PF10392 | COG5_N | 588 | 641 | 3.0 | 8.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.