RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G614470
Reference: TK1151 Chr: Chr01 Coordinates: 154952271-154955323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1354 bp · TkA01G614470|TK1151|cDNA

TTTGGGACGGAGGGAGTACAAGACATATTTCAGATATTTGGATCATTTTTAGGAAGTAGTTTCTGAAATTTCTGATTTAATTTGTATATTCTGGTGGCCGTAAAAATTATGGAGGACAACGACGGATCATCCTTAATAGTTAAGACACCAGTGTCGGATTCGGTCCCCCGCACACCGGTCCCCGCCCTACCACCATATCCTTAGCTTAGCACACTCTTTCTCTTTCTCTCTCTATGGAACACACCCAAAAGGCATCTTAT...

CDS

Download CDS FASTA

987 bp · TkA01G614470|TK1151|CDS

ATGGAGAAACATGAAGAATTGGGTGTGGAATCGTTTCAATTCGGCGAAGACGATATTCAGAGCCTGATGTCGGTGGTACCACCGCCTGAGGCCGGCAATTCTTTCACGGCTCTTCTCGAACTCCCACCAAACCAGGCCGTGAAGCTCTTACACTCCCCTGAAGAAACCACACCCAGTATATTCCCCCCTTCTGTGTTTCCCACCATGGACACCGACAATTCGCTGGAGACGACGAGCTCAATTCTCCCAAATTCGAGCCC...

Protein

Download Protein FASTA

328 aa · TkA01G614470|TK1151|PROTEIN

MEKHEELGVESFQFGEDDIQSLMSVVPPPEAGNSFTALLELPPNQAVKLLHSPEETTPSIFPPSVFPTMDTDNSLETTSSILPNSSPNFSNLVKQEPIDSDSPHNSSPMHSDPIISKLTKRKEREKKVKASAKKIKNVATETDGEKLPYVHVRARRGQATDSHSLAERARREKINARMKLLQELVPGCNKISGTAMVLDEIINHVQTLQRQVEFLSMRLAAVHPCIDINLDNIFSAESGSLMDCNFAGMVSLQGQMNGNS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G614470
TK1151 IDTkA01G614470
OH-1004 IDLXL04_000398
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)97.300
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G614470
LocationChr01:154952271-154955323 (+)
DescriptionSimilar to BHLH48: Transcription factor bHLH48
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g42300 Transcription factor bHLH48. No verified direct reference in this release
At3g57800 Transcription factor bHLH60. No verified direct reference in this release
At4g34530 Transcription factor that binds DNA to G box 5'-CACGTG-3' and, to a lower extent, to E-box 5'-CANNTG-3' in vitro.
Photoexcited CRY2 interacts with CIB1 to regulate transcription and floral initiation in Arabidopsis.2008 · DOI: 10.1126/science.1163927
Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: B8AH97 Together with BCL1, positive regulator of cell elongation at least partially through increased gibberellic acid (GA) biosynthesis. No verified direct reference in this release
Os02g0705500 Together with BCL1, positive regulator of cell elongation at least partially through increased gibberellic acid (GA) biosynthesis.
Modulation of Rice Leaf Angle and Grain Size by Expressing OsBCL1 and OsBCL2 under the Control of OsBUL1 Promoter.2021 · DOI: 10.3390/ijms22157792
Os07g0193800 Transcription factor that forms a ternary complex with RSS3 and TIFY11A/JAZ9 to negatively regulate jasmonate-responsive genes. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000398 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009637 response to blue light Biological Process
GO:0009740 gibberellic acid mediated signaling pathway Biological Process
GO:0009908 flower development Biological Process
GO:0009911 positive regulation of flower development Biological Process
GO:0010372 positive regulation of gibberellin biosynthetic process Biological Process
GO:0045824 negative regulation of innate immune response Biological Process
GO:0051510 regulation of unidimensional cell growth Biological Process
GO:0005634 nucleus Cellular Component
GO:0003677 DNA binding Molecular Function
GO:0003700 DNA-binding transcription factor activity Molecular Function
KEGG gene cross-reference
ath:AT2G42300
ath:AT3G57800
ath:AT4G34530
dosa:Os02g0705500
osa:4330462
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976
Rank 1 · TkA01G614470 · TK1151
Cytoplasm0.103
Rank 2 · TkA01G614470 · TK1151
Cell membrane0.024
Rank 3 · TkA01G614470 · TK1151
Endoplasmic reticulum0.016
Rank 4 · TkA01G614470 · TK1151
Plastid0.011
Rank 5 · TkA01G614470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH19-29 aa
PF23173bHLH_SAC5122-30 aa
PF23177bHLH_IRO3119-145 aa
PF23177bHLH_IRO3161-216 aa
PF00010HLH162-209 aa
PF23173bHLH_SAC51167-211 aa
PF23176bHLH_LHW171-210 aa
PF23174bHLH_ILI176-228 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G614470PF00010HLH19295.5e-0730.0
TkA01G614470PF23173bHLH_SAC5122304.4e-0627.2
TkA01G614470PF23177bHLH_IRO31191450.113.7
TkA01G614470PF23177bHLH_IRO31612160.113.7
TkA01G614470PF00010HLH1622095.5e-0730.0
TkA01G614470PF23173bHLH_SAC511672114.4e-0627.2
TkA01G614470PF23176bHLH_LHW1712100.03814.7
TkA01G614470PF23174bHLH_ILI1762280.1113.6
TkA01G614470PF23176bHLH_LHW2402540.03814.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8VZ02Arabidopsis thalianasp|Q8VZ02|BH048_ARATH Transcription factor bHLH4846.400%Swiss-ProtMedium
Q3EAI1Arabidopsis thalianasp|Q3EAI1|BH060_ARATH Transcription factor bHLH6040.300%Swiss-ProtMedium
Q8GY61Arabidopsis thalianasp|Q8GY61|BH063_ARATH Transcription factor bHLH6360.300%Swiss-ProtLow
B8AH97Oryza sativa subsp. indicasp|B8AH97|BCL2_ORYSI Basic helix-loop-helix protein 7956.900%Swiss-ProtLow
Q6Z2G7Oryza sativa subsp. japonicasp|Q6Z2G7|BCL2_ORYSJ Basic helix-loop-helix protein 7956.900%Swiss-ProtLow
Q69WS3Oryza sativa subsp. japonicasp|Q69WS3|BH094_ORYSJ Transcription factor BHLH09470.500%Swiss-ProtLow

JBrowse

View in Genome Browser