TkA01G612770 | RubberDandelionOmics

Gene overview

TkA01G612770

Reference: TK1151 Chr: Chr01 Coordinates: 154468154-154470821 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1897 bp · TkA01G612770|TK1151|cDNA

TGTAAAGCTATTTTTCATAGATTGGCCTTGTGACACACTAGTGGCGACCTATTCTTACTTCTTTTTCCCATTTAAAGACATTGACTTAGTTGTATAACTAAAAGGGCTGACGTTACCAATTCATCTATACATGAGGGACCTTAGTGTATGTAAAGGATCCTTTAAAACTATGTGTTGTTGCCTCACCCTCCAGCGACGTTTTCTCTCTCGCTCCTCCTGTCGCCGCCGCCGTCCACCGGCGCCCTCAACCGTTACACTCA...

CDS

Download CDS FASTA

1140 bp · TkA01G612770|TK1151|CDS

ATGTTTTCTTGGGTGGGGAGATTAGCATCAGCATTCTGGTTACCTTTAAGTCTTTATGCCCGTACGAACAAGGATGACAGCTTAGGTGACGACAAAGATCCTCTTCTATGGTCTAAAGATCTCGAAAAACACGCATTCGGAGAATTCTCATTTGCAGTCGTACAGGCGAACGAAGTTTTAGAAGATCACAGTCAGGTAGAAATAGGTCAAAACGCGACCTTCGTCGGCGTCTACGATGGCCATGGTGGCCCAGAAGCCTC...

Protein

Download Protein FASTA

379 aa · TkA01G612770|TK1151|PROTEIN

MFSWVGRLASAFWLPLSLYARTNKDDSLGDDKDPLLWSKDLEKHAFGEFSFAVVQANEVLEDHSQVEIGQNATFVGVYDGHGGPEASRYICDNLFPHLIRIAQENGLTSSNNLKNAVSATEDGFLSLVRRTCGIKPLMAAVGSCCLAGFISEGTLYVANMGDSRVVIGRLLNKRKSNKIVAEQITEDHNASIDEIRKELKSDHPDDPHIVVMKQGVWRIKGIIQVSRTIGDAYLKKPEFAIDPSFPRFHLRDPIRRPVLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G612770`
TK1151 ID	TkA01G612770
OH-1004 ID	LXL04_000422
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.945 / OH-1004 79.787 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G612770

Location Chr01:154468154-154470821 (-)

Description Similar to Os04g0584300: Probable protein phosphatase 2C 43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06750`	May dephosphorylate and repress plasma membrane H(+)-ATPases (PM H(+)-ATPases, e.g. AHA1 and AHA2), thus influencing negatively plant growth and fitness.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q7XUC5`	Probable protein phosphatase 2C 43.	No verified direct reference in this release
`Os02g0685600`	Probable protein phosphatase 2C 25.	No verified direct reference in this release
`Os06g0717800`	Probable protein phosphatase 2C 60.	No verified direct reference in this release
`Os03g0137200`	Probable protein phosphatase 2C 28.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000422 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G06750

dosa:Os02g0685600

dosa:Os03g0137200

dosa:Os06g0717800

osa:4331548

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.285

Rank 1 · TkA01G612770 · TK1151

Cytoplasm0.277

Rank 2 · TkA01G612770 · TK1151

Nucleus0.235

Rank 3 · TkA01G612770 · TK1151

Endoplasmic reticulum0.114

Rank 4 · TkA01G612770 · TK1151

Golgi apparatus0.090

Rank 5 · TkA01G612770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13672PP2C_255-169 aa

PF00481PP2C70-314 aa

PF07228SpoIIE144-167 aa

PF07228SpoIIE171-212 aa

PF08159NUC153236-253 aa

PF07228SpoIIE269-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G612770	`PF13672`	PP2C_2	55	169	0.016	15.5
TkA01G612770	`PF00481`	PP2C	70	314	7.7e-32	111.7
TkA01G612770	`PF07228`	SpoIIE	144	167	0.049	14.3
TkA01G612770	`PF07228`	SpoIIE	171	212	0.049	14.3
TkA01G612770	`PF08159`	NUC153	236	253	0.08	13.5
TkA01G612770	`PF07228`	SpoIIE	269	348	0.049	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JD5`	Arabidopsis thaliana	sp\|Q84JD5\|P2C68_ARATH Probable protein phosphatase 2C 68	60.100%	Swiss-Prot	High
`Q7XUC5`	Oryza sativa subsp. japonica	sp\|Q7XUC5\|P2C43_ORYSJ Probable protein phosphatase 2C 43	63.800%	Swiss-Prot	High
`Q6ZHC8`	Oryza sativa subsp. japonica	sp\|Q6ZHC8\|P2C25_ORYSJ Probable protein phosphatase 2C 25	61.900%	Swiss-Prot	High
`Q5Z8P0`	Oryza sativa subsp. japonica	sp\|Q5Z8P0\|P2C60_ORYSJ Probable protein phosphatase 2C 60	53.100%	Swiss-Prot	High
`Q10S32`	Oryza sativa subsp. japonica	sp\|Q10S32\|P2C28_ORYSJ Probable protein phosphatase 2C 28	51.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card