Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1606 bp · TkA01G604870|TK1151|cDNA
TATTAGTTGAGAACTTGAGATAGGTCAGCGACAGAAGTTTGGCTCCCTACATCGCTGGCACACCGTGTTCTTACCATGGTCAGCCCCTTCTTTTCCTTTAGAAATCGACAGCTGTCTACAGGTTGATCATTGTGCGCGTCAACAGTCATTCGTTCGCTCATCTCTTTCCCCATCTTTGCTAGATTGCGCCGGGAGGAGACTAGTGCACCATTAAGAAAATAGAGGCACCCAAACAGAGAAGAAGGAGGAAGTGGCGCATC...
657 bp · TkA01G604870|TK1151|CDS
ATGATTTCCTTTTGTGCTTGGTATAAGTGTGTATATATATTTATATATACGCTATTTTTAGGGCTTTTTCTTGGACTCTCTTCCAACTCTTCAATGGCCGCTCCACCGGCAAGGGCACGAGCAGATTATGATTACCACATTAAGCTCCTTCTGATCGGCGATAGCGGAGAACTAGTTGAATTTCTCGAAATTGCCATCACATCAATTATTTTCCACAAAGGAATCTACCCTCCTGGTGCGTTTGAAAGGCGGCGATTCAT...
Protein
Download Protein FASTA218 aa · TkA01G604870|TK1151|PROTEIN
MISFCAWYKCVYIFIYTLFLGLFLGLSSNSSMAAPPARARADYDYHIKLLLIGDSGELVEFLEIAITSIIFHKGIYPPGAFERRRFMNLLVHRARHPQLNRYIHDSVNALAPYIQQGLVERIAIIFFKDDRIPVERFIFKMNVNVNQRCEDGGENMMMDVRSFLMKLSLSEPLSDVVSQGLMELTQIYRPILTENRVIDPFSLRPQETAISLTGMILH
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G604870 |
|---|---|
| TK1151 ID | TkA01G604870 |
| OH-1004 ID | LXL04_000527 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 96.600 |
| Protein coverage (%) | TK1151 67.890 / OH-1004 78.307Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G604870 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:152419253-152429368 (+) | |||||||||
| Description | Similar to REV7: DNA polymerase zeta processivity subunit | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001558 regulation of cell growth Biological Process GO:0006281 DNA repair Biological Process GO:0006302 double-strand break repair Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006974 DNA damage response Biological Process GO:0009794 regulation of mitotic cell cycle, embryonic Biological Process GO:0010224 response to UV-B Biological Process GO:0031145 anaphase-promoting complex-dependent catabolic process Biological Process GO:0031397 negative regulation of protein ubiquitination Biological Process GO:0033138 positive regulation of peptidyl-serine phosphorylation Biological Process GO:0042177 negative regulation of protein catabolic process Biological Process GO:0042772 DNA damage response, signal transduction resulting in transcription Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G16590 bta:506605 dre:550258 xla:394380 xtr:448122 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02301HORMA60-169 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G604870 | PF02301 | HORMA | 60 | 169 | 1.3e-07 | 32.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.