TkA01G595700 | RubberDandelionOmics

Gene overview

TkA01G595700

Reference: TK1151 Chr: Chr01 Coordinates: 149998759-149999587 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

426 bp · TkA01G595700|TK1151|cDNA

ATGAAGGCCATTGCTCTTTCTCTACAAGATTCACCAGGCTTTTTGGATGTAATGACCAAAACTCCCCCTAAAAAGGCAAATGCGTCAGTTGTTGAAAACACTGAAAGTAAGCAGATTGTACATAAAGATGATTATGGAAACTGGAAGAGAAAAAACTCGTTTGCAAGTCGAGTTCAAATGACAGAGGATGAATTAATCCTACTTTTTTTTCAGTTCGATGAAGTGGGGAAAGGGGGGATAAGTTTAAGGGATTTGAGAAG...

CDS

Download CDS FASTA

426 bp · TkA01G595700|TK1151|CDS

ATGAAGGCCATTGCTCTTTCTCTACAAGATTCACCAGGCTTTTTGGATGTAATGACCAAAACTCCCCCTAAAAAGGCAAATGCGTCAGTTGTTGAAAACACTGAAAGTAAGCAGATTGTACATAAAGATGATTATGGAAACTGGAAGAGAAAAAACTCGTTTGCAAGTCGAGTTCAAATGACAGAGGATGAATTAATCCTACTTTTTTTTCAGTTCGATGAAGTGGGGAAAGGGGGGATAAGTTTAAGGGATTTGAGAAG...

Protein

Download Protein FASTA

141 aa · TkA01G595700|TK1151|PROTEIN

MKAIALSLQDSPGFLDVMTKTPPKKANASVVENTESKQIVHKDDYGNWKRKNSFASRVQMTEDELILLFFQFDEVGKGGISLRDLRRVAASHDFTWTDEEMKHMIDFFDTDADARLSLEDFNKIVERCNMRQGSENSQLPS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G595700`
TK1151 ID	TkA01G595700
OH-1004 ID	LXL04_024996
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.800
Protein coverage (%)	TK1151 100.000 / OH-1004 92.810 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G595700`
Location	Chr01:149998759-149999587 (+)
Description	Similar to Cetn1: Centrin-1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024996` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000226 microtubule cytoskeleton organization Biological Process GO:0000278 mitotic cell cycle Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006406 mRNA export from nucleus Biological Process GO:0007098 centrosome cycle Biological Process GO:0007099 centriole replication Biological Process GO:0007283 spermatogenesis Biological Process GO:0015031 protein transport Biological Process GO:0032465 regulation of cytokinesis Biological Process GO:0034605 cellular response to heat Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0051028 mRNA transport Biological Process
KEGG gene cross-reference	bta:512850 hsa:1069 hsa:1070 mmu:12626 mmu:26369 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA01G595700 · TK1151

Nucleus0.340

Rank 2 · TkA01G595700 · TK1151

Cell membrane0.130

Rank 3 · TkA01G595700 · TK1151

Golgi apparatus0.063

Rank 4 · TkA01G595700 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA01G595700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02809UIM2-11 aa

PF02421FeoB_N5-82 aa

PF00235Profilin38-81 aa

PF13833EF-hand_855-87 aa

PF09832DUF205960-65 aa

PF02809UIM61-65 aa

PF13499EF-hand_763-125 aa

PF13405EF-hand_665-90 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G595700	`PF02809`	UIM	2	11	1.3	9.8
TkA01G595700	`PF02421`	FeoB_N	5	82	0.23	11.7
TkA01G595700	`PF00235`	Profilin	38	81	0.076	13.8
TkA01G595700	`PF13833`	EF-hand_8	55	87	0.00011	22.6
TkA01G595700	`PF09832`	DUF2059	60	65	0.27	12.0
TkA01G595700	`PF02809`	UIM	61	65	1.3	9.8
TkA01G595700	`PF13499`	EF-hand_7	63	125	5.2e-07	30.6
TkA01G595700	`PF13405`	EF-hand_6	65	90	0.00063	20.0
TkA01G595700	`PF00036`	EF-hand_1	68	89	0.016	15.5
TkA01G595700	`PF21008`	AIF-1	69	124	0.17	12.8
TkA01G595700	`PF00235`	Profilin	82	112	0.076	13.8
TkA01G595700	`PF13833`	EF-hand_8	96	127	0.00011	22.6
TkA01G595700	`PF09832`	DUF2059	97	112	0.27	12.0
TkA01G595700	`PF02809`	UIM	99	100	1.3	9.8
TkA01G595700	`PF13405`	EF-hand_6	100	126	0.00063	20.0
TkA01G595700	`PF00036`	EF-hand_1	100	126	0.016	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card