TkA01G595620 | RubberDandelionOmics

Gene overview

TkA01G595620

Reference: TK1151 Chr: Chr01 Coordinates: 149979910-149981457 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1160 bp · TkA01G595620|TK1151|cDNA

AAAATTCAACTATGGCTAACATGGTCAAGAGAAGTTCACCTTGCAACAGAGTCGCCGAATAGACTCAAATACTACCTCCTCCTCACCCTTCCGGCTCCCCAGATAGCCGGCGTCGCCGCCGTTAATCCTCACACTCGCTGCGTGTTCTCCTCAGCCCAGCCTACCGATTCACCGTTTCTGGTGTTCGATAAAATGCCAGGCCCAAAATTTCCATATGGGAGTCTTGTCAGCCATACAAAAGCAATGTGGAGGTCAACGGC...

CDS

Download CDS FASTA

885 bp · TkA01G595620|TK1151|CDS

AAAATTCAACTATGGCTAACATGGTCAAGAGAAGTTCACCTTGCAACAGAGTCGCCGAATAGACTCAAATACTACCTCCTCCTCACCCTTCCGGCTCCCCAGATAGCCGGCGTCGCCGCCGTTAATCCTCACACTCGCTGCGTGTTCTCCTCAGCCCAGCCTACCGATTCACCGTTTCTGGTGTTCGATAAAATGCCAGGCCCAAAATTTCCATATGGGAGTCTTGTCAGCCATACAAAAGCAATGTGGAGGTCAACGGC...

Protein

Download Protein FASTA

294 aa · TkA01G595620|TK1151|PROTEIN

KIQLWLTWSREVHLATESPNRLKYYLLLTLPAPQIAGVAAVNPHTRCVFSSAQPTDSPFLVFDKMPGPKFPYGSLVSHTKAMWRSTAMGNHVQQLNPIRTILYSHSTIIQTPTHNYSTETYTISKRQIGDNISRPEKINFLLKILTDLDNSKESVYNALDAWVAWEQDFPIGPLRRALITLEKDHQWHRVIHVIKWMLSKGQGTTMGTYGQLVRALDMDNRAEEAHEIWVKKLAVDLHSVPWQLCHQMMCVYYRNNMVER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G595620`
TK1151 ID	TkA01G595620
OH-1004 ID	LXL04_000657
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 86.982 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G595620

Location Chr01:149979910-149981457 (+)

Description Similar to At4g18975: Pentatricopeptide repeat-containing protein At4g18975, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18975`	Pentatricopeptide repeat-containing protein At4g18975, chloroplastic.	No verified direct reference in this release
`At4g21190`	Pentatricopeptide repeat-containing protein At4g21190.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000657 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT4G18975

ath:AT4G21190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.631

Rank 1 · TkA01G595620 · TK1151

Plastid0.248

Rank 2 · TkA01G595620 · TK1151

Nucleus0.071

Rank 3 · TkA01G595620 · TK1151

Cytoplasm0.032

Rank 4 · TkA01G595620 · TK1151

Cell membrane0.012

Rank 5 · TkA01G595620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01535PPR218-229 aa

PF01535PPR248-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G595620	`PF01535`	PPR	218	229	0.22	12.6
TkA01G595620	`PF01535`	PPR	248	267	0.22	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2V3H0`	Arabidopsis thaliana	sp\|Q2V3H0\|PP322_ARATH Pentatricopeptide repeat-containing protein At4g18975, chloroplastic	42.700%	Swiss-Prot	Medium
`Q8LG95`	Arabidopsis thaliana	sp\|Q8LG95\|PP332_ARATH Pentatricopeptide repeat-containing protein At4g21190	40.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card