TkA01G594930 | RubberDandelionOmics

Gene overview

TkA01G594930

Reference: TK1151 Chr: Chr01 Coordinates: 149814550-149819919 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2659 bp · TkA01G594930|TK1151|cDNA

ATGTAGTAAATTCTTAACTTCAAGGGTCATGTTGACTGCACAACCAGTATAAATTAACATCTCAGAACTAGATTAGATCACTGTGAGTAGGTAACATGGAGGTCAGTCGTTGCAATAATCGCCGATCAAAGCTTCTGCTACTTCTTCTGATCGTTTCTGTAGCCACGAATCTCGTCGCGGCATCTGCAGCGTCGTCGTCCGTCGCCGTCGCTGGCGAAGAAAAAGTGAAGCTGACTTTATACTACGAAGCCCTGTGTCCA...

CDS

Download CDS FASTA

1173 bp · TkA01G594930|TK1151|CDS

ATGTACTGGCGTAACATGCGTAAAGTGATGGTGTACGAAATAATGAGCAGCAAGAACATGGAAGCTTCACTCTCTTTGCGGAGAAATGGCGTGAGAAAAACCATCAAGCATGTGTATGAATCAATGGGGACTGGGGTGAACATTGCTGATATTGCATTCTCGACATCGCTGAGCGTCGTAACAAGCTTGGTATTAGGGAAAAGTCTGGATCAAGATGAACAAAATCATAACCTTGGTGAGGATAGACTTCAGGATGTGAT...

Protein

Download Protein FASTA

390 aa · TkA01G594930|TK1151|PROTEIN

MYWRNMRKVMVYEIMSSKNMEASLSLRRNGVRKTIKHVYESMGTGVNIADIAFSTSLSVVTSLVLGKSLDQDEQNHNLGEDRLQDVITRLIDLLGAQKISGFLPILARLDLQGVQEKINCEFHKFDEILQRIIDDRLSVKSKESTENHGRKDFLQILLELRQQNSSSSYSIPQIKALLVVVFVAGTDTSASMVEWAMAELLKYPEVMKKTREELEQVIGLDTIVEESHLPKLRYLDAVINEALRLHPPLPFLIRQSPNES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G594930`
TK1151 ID	TkA01G594930
OH-1004 ID	LXL04_014824
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	61.800
Protein coverage (%)	TK1151 100.000 / OH-1004 74.187 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G594930

Location Chr01:149814550-149819919 (+)

Description Similar to CYP93A1: 3,9-dihydroxypterocarpan 6A-monooxygenase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45560`	Cytochrome P450 76C1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014824 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0016099 monoterpenoid biosynthetic process Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen Molecular Function

GO:0020037 heme binding Molecular Function

GO:0033772 flavonoid 3',5'-hydroxylase activity Molecular Function

KEGG gene cross-reference

ag:CAC80883

gmx:100776878

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.907

Rank 1 · TkA01G594930 · TK1151

Cytoplasm0.044

Rank 2 · TkA01G594930 · TK1151

Cell membrane0.034

Rank 3 · TkA01G594930 · TK1151

Plastid0.030

Rank 4 · TkA01G594930 · TK1151

Nucleus0.026

Rank 5 · TkA01G594930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p4503-374 aa

PF03773ArsP_137-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G594930	`PF00067`	p450	3	374	7.5e-77	259.8
TkA01G594930	`PF03773`	ArsP_1	37	126	0.17	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64636`	Arabidopsis thaliana	sp\|O64636\|C76C1_ARATH Cytochrome P450 76C1	36.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card