TkA01G594920 | RubberDandelionOmics

Gene overview

TkA01G594920

Reference: TK1151 Chr: Chr01 Coordinates: 149811141-149813058 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1170 bp · TkA01G594920|TK1151|cDNA

TACCAAAGTACCTAAAATATCAGTATTCCCTCTTTCTTTTATAACTACCACTCTGACTGTTTCCTGAAGCCATTGAAACTGAAGCTCAACAGATTTCAACCATGGAAGCTCGCCTTCTGTTTATCTTCGTCATCTGCGTGATATCAGTAACGTGTTCATCATCATCTGATTTGGTAGAGATCGTTCCTATGAAAGAAGTAGAAAAGGTTCAAGTAACGGTCTACTACGAATCGCTCTGTCCTTTCTGCGAGAATTTCATC...

CDS

Download CDS FASTA

804 bp · TkA01G594920|TK1151|CDS

ATGGAAGCTCGCCTTCTGTTTATCTTCGTCATCTGCGTGATATCAGTAACGTGTTCATCATCATCTGATTTGGTAGAGATCGTTCCTATGAAAGAAGTAGAAAAGGTTCAAGTAACGGTCTACTACGAATCGCTCTGTCCTTTCTGCGAGAATTTCATCGTCAATTATCTGATCGATGTGTTTACTGAAGGAATCGACGCCATAGCCGATGTAAAACTCTTTCCTTATGGTAACGCTAAAGTCAATGCCAACGGCAACAT...

Protein

Download Protein FASTA

267 aa · TkA01G594920|TK1151|PROTEIN

MEARLLFIFVICVISVTCSSSSDLVEIVPMKEVEKVQVTVYYESLCPFCENFIVNYLIDVFTEGIDAIADVKLFPYGNAKVNANGNITCQHGELECVFNTVEACAINAWPDVHDHFPFIFCVERYLYHDKSDQWESCFKELSLDPKPVKDCYNSGFGNQLELQYAVETDSLKPPKKYVPWVVVDGKPLYDDYIYIITRICSVYKGPSLPKACLRCLALSENQNRIGEPQDKLIPLHPVTYPEESGMFSKIRFSLMSWMFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G594920`
TK1151 ID	TkA01G594920
OH-1004 ID	LXL04_000667
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	54.600
Protein coverage (%)	TK1151 85.768 / OH-1004 82.510 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G594920

Location Chr01:149811141-149813058 (+)

Description Similar to GILT: Gamma-interferon-responsive lysosomal thiol protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g12960`	Lysosomal thiol reductase that can reduce protein disulfide bonds.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000667 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0019886 antigen processing and presentation of exogenous peptide antigen via MHC class II Biological Process

GO:0042590 antigen processing and presentation of exogenous peptide antigen via MHC class I Biological Process

GO:0048147 negative regulation of fibroblast proliferation Biological Process

GO:0050821 protein stabilization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0030054 cell junction Cellular Component

GO:0015036 disulfide oxidoreductase activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016667 oxidoreductase activity, acting on a sulfur group of donors Molecular Function

KEGG gene cross-reference

ath:AT4G12960

bta:615930

cel:CELE_F37H8.5

mmu:65972

rno:290644

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.484

Rank 1 · TkA01G594920 · TK1151

Endoplasmic reticulum0.198

Rank 2 · TkA01G594920 · TK1151

Cytoplasm0.158

Rank 3 · TkA01G594920 · TK1151

Extracellular0.150

Rank 4 · TkA01G594920 · TK1151

Cell membrane0.105

Rank 5 · TkA01G594920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13462Thioredoxin_435-67 aa

PF03227GILT37-140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G594920	`PF13462`	Thioredoxin_4	35	67	0.26	12.2
TkA01G594920	`PF03227`	GILT	37	140	2.2e-31	109.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV73`	Arabidopsis thaliana	sp\|Q9SV73\|GILT_ARATH Gamma-interferon-responsive lysosomal thiol protein	44.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card