TkA01G592680 | RubberDandelionOmics

Gene overview

TkA01G592680

Reference: TK1151 Chr: Chr01 Coordinates: 149160533-149165091 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2356 bp · TkA01G592680|TK1151|cDNA

TATTAAAACGCCCCAAATATATTTAATTTTAAAATTTCTTTGAAAATAAACCCTAATTTCAAGATTCTGTACCGAGATAATCCTTATGGCATGTCTACTTCGCTGAGATTCGGGCTTAAGATTGAGCATCAACCGCAGCAGACCATTCCACACACACTCTCTCTGAACACTCATCCATCCAAACAATGTCTTATGTGCCTCCTCACCTCCGTAAGTCAATCGCCGCCACCACTACCACAACCACCACCACCACCACCACA...

CDS

Download CDS FASTA

1698 bp · TkA01G592680|TK1151|CDS

ATGTCTTATGTGCCTCCTCACCTCCGTAAGTCAATCGCCGCCACCACTACCACAACCACCACCACCACCACCACAACCGCCACCCCCACAAACCTAGAAAACATCCCAACAAACCACAAACTGAACTCTAAATCCAACAACAATGCGTTTTCTAATTCAACTCCTAGACGGAGCTCAGCCAACAACCACATCCAGCCGTCGAGAGCTCTCGCTGTTCCTAACGTAGTGTTTCCTCAATGGAAGCCTTCCGAACGCGTTCT...

Protein

Download Protein FASTA

565 aa · TkA01G592680|TK1151|PROTEIN

MSYVPPHLRKSIAATTTTTTTTTTTTATPTNLENIPTNHKLNSKSNNNAFSNSTPRRSSANNHIQPSRALAVPNVVFPQWKPSERVLRLKPEQIEEVRLRLNVDVTVTPDSPTAPAPIESFTDMCLDSSIMKDIAIHEYTTPTSIQAQAMPVALSGRDLLGCAETGSGKTAAFTIPMIQHCIAQVPVRRGDGPLALVLAPTRELAQQIEKEVKAFSQSLESFRTAIVVGGTNIADQRSELRTGVDIVVATPGRFIDHLQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G592680`
TK1151 ID	TkA01G592680
OH-1004 ID	LXL04_000711
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G592680`
Location	Chr01:149160533-149165091 (-)
Description	Similar to DBP2: ATP-dependent RNA helicase DBP2 (Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000711` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process GO:0000380 alternative mRNA splicing, via spliceosome Biological Process GO:0006364 rRNA processing Biological Process GO:0006369 termination of RNA polymerase II transcription Biological Process GO:0071042 nuclear polyadenylation-dependent mRNA catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0002151 G-quadruplex RNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003724 RNA helicase activity Molecular Function GO:0003729 mRNA binding Molecular Function
KEGG gene cross-reference	ago:AGOS_AFL221C cgr:2890547 dha:DEHA2A12958g dosa:Os06g0602400 kla:KLLA0_F23716g These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.541

Rank 1 · TkA01G592680 · TK1151

Cytoplasm0.504

Rank 2 · TkA01G592680 · TK1151

Mitochondrion0.049

Rank 3 · TkA01G592680 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA01G592680 · TK1151

Cell membrane0.033

Rank 5 · TkA01G592680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270DEAD9-34 aa

PF05086Dicty_REP12-62 aa

PF00270DEAD143-313 aa

PF00176SNF2-rel_dom162-279 aa

PF04851ResIII163-308 aa

PF00271Helicase_C188-240 aa

PF22590Cas3-like_C_2206-236 aa

PF00176SNF2-rel_dom290-349 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G592680	`PF00270`	DEAD	9	34	4e-52	177.0
TkA01G592680	`PF05086`	Dicty_REP	12	62	2.0	7.1
TkA01G592680	`PF00270`	DEAD	143	313	4e-52	177.0
TkA01G592680	`PF00176`	SNF2-rel_dom	162	279	0.0002	21.3
TkA01G592680	`PF04851`	ResIII	163	308	1.3e-08	35.6
TkA01G592680	`PF00271`	Helicase_C	188	240	1.5e-31	109.6
TkA01G592680	`PF22590`	Cas3-like_C_2	206	236	0.13	13.3
TkA01G592680	`PF00176`	SNF2-rel_dom	290	349	0.0002	21.3
TkA01G592680	`PF00271`	Helicase_C	294	355	1.5e-31	109.6
TkA01G592680	`PF00271`	Helicase_C	368	467	1.5e-31	109.6
TkA01G592680	`PF22590`	Cas3-like_C_2	379	466	0.13	13.3
TkA01G592680	`PF00270`	DEAD	395	429	4e-52	177.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card