TkA01G585810 | RubberDandelionOmics

Gene overview

TkA01G585810

Reference: TK1151 Chr: Chr01 Coordinates: 147342733-147343578 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

705 bp · TkA01G585810|TK1151|cDNA

ATGTTTGCAAAAAACTACGTTGAAATTCGCCGGCATAAGAAGCTTACCTGGATTCACCATAATGACGCTGTTTCTTCATTGGCGGTGTCCATGGATAAGTCTTTGATTTACTCCGCTTCATGGGATCGAAGTTTTAAGGTTTGGAGAAGCTCCGATTTCAAGTGTTTGGAATCAATATCAAACGCTCACGACGACGCCATTAACGCCATAGTTTTATCTGTTGAAGGTTTCGTTTACACAGGTTCAGCTGACAAAAAGAT...

CDS

Download CDS FASTA

705 bp · TkA01G585810|TK1151|CDS

ATGTTTGCAAAAAACTACGTTGAAATTCGCCGGCATAAGAAGCTTACCTGGATTCACCATAATGACGCTGTTTCTTCATTGGCGGTGTCCATGGATAAGTCTTTGATTTACTCCGCTTCATGGGATCGAAGTTTTAAGGTTTGGAGAAGCTCCGATTTCAAGTGTTTGGAATCAATATCAAACGCTCACGACGACGCCATTAACGCCATAGTTTTATCTGTTGAAGGTTTCGTTTACACAGGTTCAGCTGACAAAAAGAT...

Protein

Download Protein FASTA

234 aa · TkA01G585810|TK1151|PROTEIN

MFAKNYVEIRRHKKLTWIHHNDAVSSLAVSMDKSLIYSASWDRSFKVWRSSDFKCLESISNAHDDAINAIVLSVEGFVYTGSADKKIKVWRHDRRDKKHYLIEKLEHHRSAVNALDYDDHASVLISGACSGAMIASERNSGGGDGGHMTVVGALIGHKKAILCGHGGPVKCLAMAAEISSNEEGKGYVVYSGSLDGDIKVWKVGFHSPWKKNLRWRNLKVEFALLLVYYFFYNI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G585810`
TK1151 ID	TkA01G585810
OH-1004 ID	LXL04_011546
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	47.100
Protein coverage (%)	TK1151 87.179 / OH-1004 44.712 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G585810

Location Chr01:147342733-147343578 (+)

Description Similar to JGB: Protein JINGUBANG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26490`	Negative regulator of pollen germination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011546 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006508 proteolysis Biological Process

GO:0009846 pollen germination Biological Process

GO:0031037 myosin II filament disassembly Biological Process

GO:1903013 response to differentiation-inducing factor 1 Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005826 actomyosin contractile ring Cellular Component

GO:0004197 cysteine-type endopeptidase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016905 myosin heavy chain kinase activity Molecular Function

KEGG gene cross-reference

ana:all2124

ath:AT2G26490

ddi:DDB_G0289115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.636

Rank 1 · TkA01G585810 · TK1151

Cytoplasm0.256

Rank 2 · TkA01G585810 · TK1151

Cell membrane0.076

Rank 3 · TkA01G585810 · TK1151

Lysosome / Vacuole0.045

Rank 4 · TkA01G585810 · TK1151

Endoplasmic reticulum0.044

Rank 5 · TkA01G585810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25171Beta-prop_WDR36-Utp21_1st8-93 aa

PF23414Beta-prop_EML_210-129 aa

PF24796WDR5512-135 aa

PF25174Beta-prop_THOC312-163 aa

PF24817WD40_WDHD1_1st12-60 aa

PF25391WD40_Gbeta13-201 aa

PF24807WD40_CDC20-Fz14-138 aa

PF00400WD4016-48 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G585810	`PF25171`	Beta-prop_WDR36-Utp21_1st	8	93	0.0059	16.8
TkA01G585810	`PF23414`	Beta-prop_EML_2	10	129	4.7e-06	26.9
TkA01G585810	`PF24796`	WDR55	12	135	4.3e-12	46.4
TkA01G585810	`PF25174`	Beta-prop_THOC3	12	163	6.5e-12	45.7
TkA01G585810	`PF24817`	WD40_WDHD1_1st	12	60	3.4e-11	43.6
TkA01G585810	`PF25391`	WD40_Gbeta	13	201	1.7e-08	34.6
TkA01G585810	`PF24807`	WD40_CDC20-Fz	14	138	1.7e-09	38.2
TkA01G585810	`PF00400`	WD40	16	48	4.6e-21	75.0
TkA01G585810	`PF24805`	EIF3I	16	61	6.6e-05	22.9
TkA01G585810	`PF23409`	Beta-prop_EML	18	40	4.5e-07	30.4
TkA01G585810	`PF25047`	Beta-prop_TEP1_2nd	18	202	3e-06	27.3
TkA01G585810	`PF23798`	Beta-prop_SPT8	18	62	0.4	10.2
TkA01G585810	`PF25175`	Beta-prop_WDR5	19	203	6.1e-18	65.8
TkA01G585810	`PF23381`	Beta-prop_IFT122_1st	19	72	1.5e-16	61.3
TkA01G585810	`PF25173`	Beta-prop_WDR3_1st	19	91	1.1e-15	58.5
TkA01G585810	`PF24814`	WD40_Prp19	19	71	3.9e-14	53.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48716`	Arabidopsis thaliana	sp\|O48716\|JGB_ARATH Protein JINGUBANG	35.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card