TkA01G581710 | RubberDandelionOmics

Gene overview

TkA01G581710

Reference: TK1151 Chr: Chr01 Coordinates: 146380746-146382842 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1032 bp · TkA01G581710|TK1151|cDNA

CAAAGTCCGAATATAATAAATGACTACCCGAGTGTGGTTTCTTCTGTACTATCGATTTTTTCCCGATACCCTTCTCCCTCTCCCTTTCCCCCAATATTCGTCCTGTGTTCGGGTATCTTTCCAATCTACTGAAAACACACATTCCCAAAGGGGCTTTAGGGTTAGGGTTTTATCATAAATTGCTCATCTAGATACGATTCCTTTGAATTGTATCGAGAATGTATGCTGATCGGGTAGAGACTGCGTCAAGGAGTTCTATT...

CDS

Download CDS FASTA

600 bp · TkA01G581710|TK1151|CDS

ATGTATGCTGATCGGGTAGAGACTGCGTCAAGGAGTTCTATTAAAGACCGTCTTAATGGCGGAGCCCTAGAAAATTCCAGTCGCCGTAGGCAAGTTGCTGGCAAGAGACAGAGGCAAGATGATGACAAATGGCAGCACGATCTTTACGACCAACCTGATCCACAAGTATCAAACCGTAAAGTAGGTGCTCTAGACCTCCGTTTGAAGCTCCAAAGGAAGAGTAATCAAGGGGCAAAGGGTTCATTATCAGGAGGTGTAAG...

Protein

Download Protein FASTA

199 aa · TkA01G581710|TK1151|PROTEIN

MYADRVETASRSSIKDRLNGGALENSSRRRQVAGKRQRQDDDKWQHDLYDQPDPQVSNRKVGALDLRLKLQRKSNQGAKGSLSGGVRDLREKLSGITHSQPAAKPKPAPETSKPPRRSVVADANVTDTKKGSTNASKRKKVETVDSFLQAQGLEKYSITFQAEEVDMTALLHMTDEDLKAMGIPMGPRKKILLALESKA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G581710`
TK1151 ID	TkA01G581710
OH-1004 ID	LXL04_000828
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G581710`
Location	Chr01:146380746-146382842 (+)
Description	Similar to SEC23IP: SEC23-interacting protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000828` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001675 acrosome assembly Biological Process GO:0006886 intracellular protein transport Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007030 Golgi organization Biological Process GO:0007286 spermatid development Biological Process GO:0007338 single fertilization Biological Process GO:0019433 triglyceride catabolic process Biological Process GO:0030154 cell differentiation Biological Process GO:0034389 lipid droplet organization Biological Process GO:0034976 response to endoplasmic reticulum stress Biological Process GO:0065003 protein-containing complex assembly Biological Process GO:0090141 positive regulation of mitochondrial fission Biological Process
KEGG gene cross-reference	hsa:11196 hsa:257629 mmu:72074 mmu:72108 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.948

Rank 1 · TkA01G581710 · TK1151

Cytoplasm0.156

Rank 2 · TkA01G581710 · TK1151

Cell membrane0.024

Rank 3 · TkA01G581710 · TK1151

Endoplasmic reticulum0.017

Rank 4 · TkA01G581710 · TK1151

Mitochondrion0.014

Rank 5 · TkA01G581710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09405Btz15-58 aa

PF06424PRP1_N17-103 aa

PF09405Btz119-126 aa

PF09597SAM_Ribosomal_mS41135-195 aa

PF06424PRP1_N137-138 aa

PF00536SAM_1139-196 aa

PF07647SAM_2139-196 aa

PF30784SAM_7140-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G581710	`PF09405`	Btz	15	58	0.033	15.1
TkA01G581710	`PF06424`	PRP1_N	17	103	0.0093	17.1
TkA01G581710	`PF09405`	Btz	119	126	0.033	15.1
TkA01G581710	`PF09597`	SAM_Ribosomal_mS41	135	195	0.00015	22.5
TkA01G581710	`PF06424`	PRP1_N	137	138	0.0093	17.1
TkA01G581710	`PF00536`	SAM_1	139	196	4e-16	59.8
TkA01G581710	`PF07647`	SAM_2	139	196	1.6e-10	41.6
TkA01G581710	`PF30784`	SAM_7	140	192	2.1e-07	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card