TkA01G579480 | RubberDandelionOmics

Gene overview

TkA01G579480

Reference: TK1151 Chr: Chr01 Coordinates: 145809892-145811091 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · TkA01G579480|TK1151|cDNA

ATGGGATCCGATGAGGAAGATCACGCCACTGCCGTCTACGGCGAAGAAGATCTCGACGAAGAAGATGATGAAGAAAGCGAAGAAGAAGACCAAACTTTACAGAATCAACACGTTGACGAGGACGATGTTGACATGATCGACGATGAAGAAGAAGACGAAGAAGAAGACGATTCTATGTCCGTCGCCCCAACTGTTGCCGCTACTCCTACAACAGCCACAACTACCACGACCTCGATTGTTCGATCCGACGCAATTGTGGA...

CDS

Download CDS FASTA

1155 bp · TkA01G579480|TK1151|CDS

ATGGGATCCGATGAGGAAGATCACGCCACTGCCGTCTACGGCGAAGAAGATCTCGACGAAGAAGATGATGAAGAAAGCGAAGAAGAAGACCAAACTTTACAGAATCAACACGTTGACGAGGACGATGTTGACATGATCGACGATGAAGAAGAAGACGAAGAAGAAGACGATTCTATGTCCGTCGCCCCAACTGTTGCCGCTACTCCTACAACAGCCACAACTACCACGACCTCGATTGTTCGATCCGACGCAATTGTGGA...

Protein

Download Protein FASTA

384 aa · TkA01G579480|TK1151|PROTEIN

MGSDEEDHATAVYGEEDLDEEDDEESEEEDQTLQNQHVDEDDVDMIDDEEEDEEEDDSMSVAPTVAATPTTATTTTTSIVRSDAIVEVKKPMPLDDSRRLFQRLWTDEDEIELLQGFLDYTTLRGTNNSSHHHHDTAAFYDQIKGKLQLDFNKNQLVEKLRRLKKKYRNVLSKLSLGKEYVFKSPHDQATFDLSCKIWSGIAATPVSIPATADGGGVDDDEPHNHNLTFNLNENNGNDIADPNSSEKKVPRPRKRSKSTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G579480`
TK1151 ID	TkA01G579480
OH-1004 ID	LXL04_000868
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G579480

Location Chr01:145809892-145811091 (+)

Description Similar to At5g28040: Probable transcription factor At5g28040

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g28040`	Probable transcription factor At5g28040.	No verified direct reference in this release
`At3g04930`	Probable transcription factor At3g04930.	No verified direct reference in this release
`At1g11510`	Probable transcription factor At1g11510.	No verified direct reference in this release
`At4g25210`	Transcription factor that binds promoters containing the CryR2 element, 5'-ACATAWCT-3'.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000868 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G11510

ath:AT3G04930

ath:AT4G00390

ath:AT4G01260

ath:AT5G28040

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.986

Rank 1 · TkA01G579480 · TK1151

Cytoplasm0.064

Rank 2 · TkA01G579480 · TK1151

Cell membrane0.017

Rank 3 · TkA01G579480 · TK1151

Endoplasmic reticulum0.012

Rank 4 · TkA01G579480 · TK1151

Plastid0.008

Rank 5 · TkA01G579480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19242Zn_finger_prot4-124 aa

PF11679DUF327526-124 aa

PF30410TrmJ_C98-122 aa

PF04504GeBP-like_DBD101-199 aa

PF13837Myb_DNA-bind_4105-174 aa

PF12776Myb_DNA-bind_3105-172 aa

PF10545MADF_DNA_bdg127-175 aa

PF30410TrmJ_C152-163 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G579480	`PF19242`	Zn_finger_prot	4	124	7.9	6.9
TkA01G579480	`PF11679`	DUF3275	26	124	0.52	10.7
TkA01G579480	`PF30410`	TrmJ_C	98	122	0.042	14.4
TkA01G579480	`PF04504`	GeBP-like_DBD	101	199	1.1e-30	106.9
TkA01G579480	`PF13837`	Myb_DNA-bind_4	105	174	0.12	13.6
TkA01G579480	`PF12776`	Myb_DNA-bind_3	105	172	0.16	13.6
TkA01G579480	`PF10545`	MADF_DNA_bdg	127	175	0.069	14.2
TkA01G579480	`PF30410`	TrmJ_C	152	163	0.042	14.4
TkA01G579480	`PF04504`	GeBP-like_DBD	248	266	1.1e-30	106.9
TkA01G579480	`PF19242`	Zn_finger_prot	257	296	7.9	6.9
TkA01G579480	`PF12776`	Myb_DNA-bind_3	361	379	0.16	13.6
TkA01G579480	`PF04504`	GeBP-like_DBD	366	379	1.1e-30	106.9
TkA01G579480	`PF10545`	MADF_DNA_bdg	366	380	0.069	14.2
TkA01G579480	`PF13837`	Myb_DNA-bind_4	366	379	0.12	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K5T4`	Arabidopsis thaliana	sp\|F4K5T4\|STKLU_ARATH Probable transcription factor At5g28040	41.900%	Swiss-Prot	Medium
`Q9CAV7`	Arabidopsis thaliana	sp\|Q9CAV7\|STKLJ_ARATH Probable transcription factor At3g04930	40.800%	Swiss-Prot	Medium
`C0SUU6`	Arabidopsis thaliana	sp\|C0SUU6\|STKLA_ARATH Probable transcription factor At1g11510	46.500%	Swiss-Prot	Low
`Q9SB42`	Arabidopsis thaliana	sp\|Q9SB42\|STKLS_ARATH GLABROUS1 enhancer-binding protein-like	40.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card