Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2978 bp · TkA01G578250|TK1151|cDNA
CACAAATAGCCAAATAGGTAATTAACTTCGCATTTTTCAGTTCAAAAAGGGCATGGGAAAACCGAGAAACGGTGTATGTTTTTCTATGGTTAGGGCATAAATTCACACTCGCACTCGACAGCCGCTCGTCGTCACTTCCGTCTATCTCTTTCCGGTTACGGACCTGCGTGTTCCTCTTGTTCGTCACCGTTGTCTGCTCGTACTACTACACAATTTAAGATAAACCAATCTTCTGTTGACCATGGGGGATAGTGAAACAG...
2343 bp · TkA01G578250|TK1151|CDS
ATGGGGGATAGTGAAACAGTTGTTGCTCAAACATCAGCTGTCCAGGAGCACCCACCTGTTCCAAGTACAGTTAATGGAGATATGGCTGCTTCTACCATGGATGTAGACAATGCCAGTTTCAGTCATGAAGCTCCATCTTCTGCTACACAAGATGGTAGTGAGAATCCTGCAAATATATCTGTAGATTCATCTCAAGTTTCTGCTTACCATTCTTCCGTGAATGGAAATGATGCCAGTGATGCAAAAGCTTTGGGTATAAA...
Protein
Download Protein FASTA780 aa · TkA01G578250|TK1151|PROTEIN
MGDSETVVAQTSAVQEHPPVPSTVNGDMAASTMDVDNASFSHEAPSSATQDGSENPANISVDSSQVSAYHSSVNGNDASDAKALGINENGVGSYDDHNPASANQPHDGSVVAALSPEEERLWSIVNTNSLDFTAWTSLIEETEKTSENNILKIRKVYDTFLAEFPLCYGYWKKYADHEARLGFLDKVVEVYERAVHGVTYSVDMWLHYCVFAINTYGDPDTVRRLFERGLAYVGTDYLSFPLWDKYIEYEFQQQNWSNLA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G578250 |
|---|---|
| TK1151 ID | TkA01G578250 |
| OH-1004 ID | LXL04_000896 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 96.700 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G578250 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:145394059-145399339 (+) | |||||||||
| Description | Similar to prpf39: Pre-mRNA-processing factor 39 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000395 mRNA 5'-splice site recognition Biological Process GO:0006397 mRNA processing Biological Process GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process GO:0048573 photoperiodism, flowering Biological Process GO:0000243 commitment complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005685 U1 snRNP Cellular Component GO:0071004 U2-type prespliceosome Cellular Component GO:0030627 pre-mRNA 5'-splice site binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G04080 ath:AT5G46400 dre:368864 hsa:55015 xla:734636 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23240HAT_PRP39_N119-282 aaPF05843Suf122-281 aaPF23233HAT_Syf1_CNRKL1_N127-268 aaPF24892UTP6_C133-165 aaPF23231HAT_Syf1_CNRKL1_C142-232 aaPF29376PRP6_TPR145-228 aaPF13432TPR_16155-195 aaPF07719TPR_2170-195 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G578250 | PF23240 | HAT_PRP39_N | 119 | 282 | 2.6e-66 | 223.5 |
| TkA01G578250 | PF05843 | Suf | 122 | 281 | 1.4e-23 | 84.0 |
| TkA01G578250 | PF23233 | HAT_Syf1_CNRKL1_N | 127 | 268 | 1.3e-15 | 58.2 |
| TkA01G578250 | PF24892 | UTP6_C | 133 | 165 | 0.18 | 12.4 |
| TkA01G578250 | PF23231 | HAT_Syf1_CNRKL1_C | 142 | 232 | 2.3e-09 | 37.2 |
| TkA01G578250 | PF29376 | PRP6_TPR | 145 | 228 | 1.4e-09 | 37.9 |
| TkA01G578250 | PF13432 | TPR_16 | 155 | 195 | 0.0084 | 17.3 |
| TkA01G578250 | PF07719 | TPR_2 | 170 | 195 | 0.021 | 15.6 |
| TkA01G578250 | PF23241 | HAT_PRP39_C | 171 | 232 | 1.5e-55 | 187.8 |
| TkA01G578250 | PF13428 | TPR_14 | 171 | 208 | 7.6e-16 | 57.8 |
| TkA01G578250 | PF29386 | CFAP70_mid_TPR | 171 | 215 | 0.44 | 11.5 |
| TkA01G578250 | PF13424 | TPR_12 | 173 | 194 | 0.00017 | 22.4 |
| TkA01G578250 | PF13374 | TPR_10 | 178 | 194 | 0.009 | 16.7 |
| TkA01G578250 | PF13176 | TPR_7 | 185 | 194 | 0.0038 | 17.9 |
| TkA01G578250 | PF24892 | UTP6_C | 186 | 229 | 0.18 | 12.4 |
| TkA01G578250 | PF14559 | TPR_19 | 190 | 231 | 1.1e-05 | 26.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.