TkA01G577660 | RubberDandelionOmics

Gene overview

TkA01G577660

Reference: TK1151 Chr: Chr01 Coordinates: 145287287-145294007 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3242 bp · TkA01G577660|TK1151|cDNA

ATGACTTAATTCTAGTCAACGCCAAGGGAAATATAATCAAGCATGGGTTCTGTATATATAATCAGAACCACCATTAAATGTACTAATTCTCCATAACCATAGAAAATTTCGACGCTTTGGTGTTCTCCATTTGAAGTTTCTTTGTCGTTTAAAAAGAATCATGTGCTTTTTCCGAGTGGTAAACATAGAAAAATATCAAATTCCACTCCACGAGATCCGTCGGGCAACAGAAAACTTCAGTTCAGAAAGCCGTATCGGAG...

CDS

Download CDS FASTA

1815 bp · TkA01G577660|TK1151|CDS

ATGTGCTTTTTCCGAGTGGTAAACATAGAAAAATATCAAATTCCACTCCACGAGATCCGTCGGGCAACAGAAAACTTCAGTTCAGAAAGCCGTATCGGAGATGGTGGATTCGGAATTGTCCACAAAGGACAACTATCGGAAGACTGGCAAAATCGCACAGTAGCCATCAAATGCCTGAAACGGGAAGGTTATCAAGGAAACAACGAGTTTCGTAACGAACTCGCCATGGTTTCTAATTTCCACCATCCAAACATCATAAC...

Protein

Download Protein FASTA

604 aa · TkA01G577660|TK1151|PROTEIN

MCFFRVVNIEKYQIPLHEIRRATENFSSESRIGDGGFGIVHKGQLSEDWQNRTVAIKCLKREGYQGNNEFRNELAMVSNFHHPNIITFIGYCDESNKMIIVYDYAVNGSLDYHLENPDKRCLLTWTQRLKICLGAAKGLKYLHSGLGEDKRVIHRDVKSANILLDDKFEAKISDFGLSKVGARNQGHTEGDITRAAGTRYYMDPLYIERSRLKKESDVYSFGVVMFELSSGTLVYIPKCFGKTTEPQYLIDAVRSYYDDD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G577660`
TK1151 ID	TkA01G577660
OH-1004 ID	LXL04_000901
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G577660

Location Chr01:145287287-145294007 (+)

Description Similar to PBL22: Probable serine/threonine-protein kinase PBL22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At2g39360`	Probable receptor-like protein kinase At2g39360.	No verified direct reference in this release
`At1g76370`	May be involved in plant defense signaling.	No verified direct reference in this release
`At3g20530`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000901 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0043680 filiform apparatus Cellular Component

GO:0090404 pollen tube tip Cellular Component

KEGG gene cross-reference

ath:AT1G76370

ath:AT2G39360

ath:AT3G46290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.467

Rank 1 · TkA01G577660 · TK1151

Cytoplasm0.454

Rank 2 · TkA01G577660 · TK1151

Nucleus0.231

Rank 3 · TkA01G577660 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA01G577660 · TK1151

Mitochondrion0.037

Rank 5 · TkA01G577660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase27-309 aa

PF07714PK_Tyr_Ser-Thr29-232 aa

PF03109ABC132-61 aa

PF05669Med3156-92 aa

PF03109ABC1150-179 aa

PF00069Pkinase349-507 aa

PF07714PK_Tyr_Ser-Thr351-505 aa

PF05669Med31378-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G577660	`PF00069`	Pkinase	27	309	1.8e-63	215.1
TkA01G577660	`PF07714`	PK_Tyr_Ser-Thr	29	232	2.3e-68	231.0
TkA01G577660	`PF03109`	ABC1	32	61	0.068	13.0
TkA01G577660	`PF05669`	Med31	56	92	0.18	12.5
TkA01G577660	`PF03109`	ABC1	150	179	0.068	13.0
TkA01G577660	`PF00069`	Pkinase	349	507	1.8e-63	215.1
TkA01G577660	`PF07714`	PK_Tyr_Ser-Thr	351	505	2.3e-68	231.0
TkA01G577660	`PF05669`	Med31	378	415	0.18	12.5
TkA01G577660	`PF03109`	ABC1	464	507	0.068	13.0
TkA01G577660	`PF26279`	PH_37	476	557	0.025	15.4
TkA01G577660	`PF07714`	PK_Tyr_Ser-Thr	511	553	2.3e-68	231.0
TkA01G577660	`PF00069`	Pkinase	511	597	1.8e-63	215.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	42.200%	Swiss-Prot	Medium
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	42.500%	Swiss-Prot	Medium
`O80623`	Arabidopsis thaliana	sp\|O80623\|Y2393_ARATH Probable receptor-like protein kinase At2g39360	39.400%	Swiss-Prot	Medium
`Q9SFX0`	Arabidopsis thaliana	sp\|Q9SFX0\|PBL22_ARATH Probable serine/threonine-protein kinase PBL22	44.000%	Swiss-Prot	Low
`F4JEQ2`	Arabidopsis thaliana	sp\|F4JEQ2\|PBL23_ARATH Probable serine/threonine-protein kinase PBL23	39.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card