TkA01G569360 | RubberDandelionOmics

Gene overview

TkA01G569360

Reference: TK1151 Chr: Chr01 Coordinates: 143309113-143310590 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · TkA01G569360|TK1151|cDNA

GAAATTCTCGCGACCACCTGGATCACCGGCGTCGAGGGTTGCAGGGGTTTATGCTCTACTCCGCCCACTCACATAAATTTTAAGATCGGAACAATGGTGTACATCATATCATGGGACGATTTTGTCGAAAGATCCCTTCAATTGTTCCGCGCTAGTCCCGAAAAAACTCGGTATGTGATGAAGTACAGACATTCTGAAGGTAAATTGGTTCTCAAGGTCACTGATGACAAAGAGTGTCTCAAGTTTAAAACAGACCAAGC...

CDS

Download CDS FASTA

402 bp · TkA01G569360|TK1151|CDS

GAAATTCTCGCGACCACCTGGATCACCGGCGTCGAGGGTTGCAGGGGTTTATGCTCTACTCCGCCCACTCACATAAATTTTAAGATCGGAACAATGGTGTACATCATATCATGGGACGATTTTGTCGAAAGATCCCTTCAATTGTTCCGCGCTAGTCCCGAAAAAACTCGGTATGTGATGAAGTACAGACATTCTGAAGGTAAATTGGTTCTCAAGGTCACTGATGACAAAGAGTGTCTCAAGTTTAAAACAGACCAAGC...

Protein

Download Protein FASTA

133 aa · TkA01G569360|TK1151|PROTEIN

EILATTWITGVEGCRGLCSTPPTHINFKIGTMVYIISWDDFVERSLQLFRASPEKTRYVMKYRHSEGKLVLKVTDDKECLKFKTDQAQDAKKMEKLNNIFFTLMARGPETDITEVTGKEQIAQPPKRGRGRKQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G569360`
TK1151 ID	TkA01G569360
OH-1004 ID	LXL04_000981
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 76.692 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G569360

Location Chr01:143309113-143310590 (+)

Description Similar to SRP9: Signal recognition particle 9 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49100`	Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER) (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000981 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process

GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition Biological Process

GO:0045900 negative regulation of translational elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005785 signal recognition particle receptor complex Cellular Component

GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0005047 signal recognition particle binding Molecular Function

GO:0008312 7S RNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G49100

cel:CELE_ZK512.4

ddi:DDB_G0267622

hsa:6726

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.551

Rank 1 · TkA01G569360 · TK1151

Cytoplasm0.396

Rank 2 · TkA01G569360 · TK1151

Mitochondrion0.095

Rank 3 · TkA01G569360 · TK1151

Cell membrane0.053

Rank 4 · TkA01G569360 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA01G569360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05486SRP9-2137-97 aa

PF26609DUF819156-102 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G569360	`PF05486`	SRP9-21	37	97	1.8e-15	57.7
TkA01G569360	`PF26609`	DUF8191	56	102	0.18	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMU7`	Arabidopsis thaliana	sp\|Q9SMU7\|SRP09_ARATH Signal recognition particle 9 kDa protein	81.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card