TkA01G566060 | RubberDandelionOmics

Gene overview

TkA01G566060

Reference: TK1151 Chr: Chr01 Coordinates: 142458720-142463022 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2446 bp · TkA01G566060|TK1151|cDNA

ATGATATAATTACCCATAAAATAAGAATTAAAAAAATATTAATTCGTGACAACGGCTTGACCTGGATTGATAAACTTGCCACGTGACTGCTATGGACTCTTACAAATCTCCGACGACACTACCGGACCTCCACTCGCAGCACCATGTCAATGGCGTCTATTATTTACCGGAAACTTCACCGGCGACCGAACAACCGGTTCAGCTATTTACAAGTAAGATTGTCATCTGCTGGTACGGATTCAAGGAACAGCGAGAAGAGT...

CDS

Download CDS FASTA

2187 bp · TkA01G566060|TK1151|CDS

ATGTCAATGGCGTCTATTATTTACCGGAAACTTCACCGGCGACCGAACAACCGGTTCAGCTATTTACAAGTAAGATTGTCATCTGCTGGTACGGATTCAAGGAACAGCGAGAAGAGTAATCGGAAGATTGAGAAGTTATTAATCGCAAACAGAGGTGAGATCGCTTGCAGGATTATGAGAACGGCGAAAAGGTTAGGGATACAGACTGTTGCTGTTTATAGCGATGCTGATAGGCATAGTCTTCATGTGAAATCCGCTGA...

Protein

Download Protein FASTA

728 aa · TkA01G566060|TK1151|PROTEIN

MSMASIIYRKLHRRPNNRFSYLQVRLSSAGTDSRNSEKSNRKIEKLLIANRGEIACRIMRTAKRLGIQTVAVYSDADRHSLHVKSADEAVRIGPPPARSSYLNASSIIEAAMRTGAQAIHPGYGFLSENADFAQLCETKGFTFIGPPASAIREMGDKSASKRIMGAAGVPLVPGYHGHEQDIDVMKSEADKIGYPLLIKPTHGGGGKGMRIVESPKEFVDAFLGAQREAAASFGVNTILLEKYITRPRHIEVQVFGDKQG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G566060`
TK1151 ID	TkA01G566060
OH-1004 ID	LXL04_001026
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G566060

Location Chr01:142458720-142463022 (-)

Description Similar to MCCA: Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g03090`	Biotin-attachment subunit of the 3-methylcrotonyl-CoA carboxylase, an enzyme that catalyzes the conversion of 3-methylcrotonyl-CoA to 3-methylglutaconyl-CoA, a critical step for leucine and isovaleric acid catabolism.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0605800`	Biotin-attachment subunit of the 3-methylcrotonyl-CoA carboxylase, an enzyme that catalyzes the conversion of 3-methylcrotonyl-CoA to 3-methylglutaconyl-CoA, a critical step for leucine and isovaleric acid catabolism.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001026 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006552 L-leucine catabolic process Biological Process

GO:0006768 biotin metabolic process Biological Process

GO:0009083 branched-chain amino acid catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:1905202 methylcrotonoyl-CoA carboxylase complex Cellular Component

GO:0004075 biotin carboxylase activity Molecular Function

GO:0004485 methylcrotonoyl-CoA carboxylase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G03090

dosa:Os12g0605800

hsa:56922

rno:294972

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.788

Rank 1 · TkA01G566060 · TK1151

Cytoplasm0.184

Rank 2 · TkA01G566060 · TK1151

Nucleus0.080

Rank 3 · TkA01G566060 · TK1151

Plastid0.053

Rank 4 · TkA01G566060 · TK1151

Peroxisome0.031

Rank 5 · TkA01G566060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00289Biotin_carb_N43-151 aa

PF02222ATP-grasp48-75 aa

PF14397ATPgrasp_ST150-214 aa

PF02786CPSase_L_D2156-364 aa

PF02222ATP-grasp174-334 aa

PF07478Dala_Dala_lig_C179-333 aa

PF30763ATP-grasp_LDMS184-266 aa

PF02655ATP-grasp_3184-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G566060	`PF00289`	Biotin_carb_N	43	151	5.7e-47	159.5
TkA01G566060	`PF02222`	ATP-grasp	48	75	6.6e-06	26.6
TkA01G566060	`PF14397`	ATPgrasp_ST	150	214	0.019	14.9
TkA01G566060	`PF02786`	CPSase_L_D2	156	364	1.4e-73	247.7
TkA01G566060	`PF02222`	ATP-grasp	174	334	6.6e-06	26.6
TkA01G566060	`PF07478`	Dala_Dala_lig_C	179	333	4.2e-10	40.2
TkA01G566060	`PF30763`	ATP-grasp_LDMS	184	266	0.0019	18.6
TkA01G566060	`PF02655`	ATP-grasp_3	184	336	0.033	15.0
TkA01G566060	`PF13535`	ATP-grasp_4	192	264	0.01	16.1
TkA01G566060	`PF02785`	Biotin_carb_C	378	485	1.1e-34	119.5
TkA01G566060	`PF00364`	Biotin_lipoyl	410	422	1.3e-16	60.9
TkA01G566060	`PF25984`	BSH_YknX	413	422	0.0002	21.8
TkA01G566060	`PF19331`	MCCA_BT	494	640	1.8e-60	204.0
TkA01G566060	`PF09891`	DUF2118	562	585	0.0042	17.7
TkA01G566060	`PF25917`	BSH_RND	594	684	3.6e-07	30.7
TkA01G566060	`PF05634`	APO_RNA-bind	646	712	0.26	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42523`	Arabidopsis thaliana	sp\|Q42523\|MCCA_ARATH Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial	72.400%	Swiss-Prot	High
`Q2QMG2`	Oryza sativa subsp. japonica	sp\|Q2QMG2\|MCCA_ORYSJ Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial	66.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card