RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G545270
Reference: TK1151 Chr: Chr01 Coordinates: 136844843-136851115 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2479 bp · TkA01G545270|TK1151|cDNA

GGAGAAAAGGAAATGGAAGGGAGGTGTAAGGAAGGAGAGGGGAAAGGAGAAATAGGCAATTAGGCATGGAGTTATTCGCTCACTTTTGGCGGGTTGGGAAGGAAAAAAAATAAAAAATACGCATTTACCCTTGGTTTCTCTCTTCAATTTGCATCACACAAGGCCCGGAAACTTCAACTGCGACTTCTTCATCTTCTCATTCAAGTTATAAACAGCCTCTGATTTTTCCTGCATCTGCGATTTTATCTTCTCAGTGGCAA...

CDS

Download CDS FASTA

1905 bp · TkA01G545270|TK1151|CDS

ATGGCTGCTGAAACTTCCTCGTCCTTAGAATTGCCACAACAGTGTCGTCAGTTTACGATCTCTGAGATCCACTTAGCAACTCGTAACTTTGATGAGTCATTGGTAATCGGGCGCGGGGGTTTTGGCATGGTTTACAAAGGAACCATCACCAATGGGACAACTCAGTTAGTTGTTGCCATTAAGCGCCTGGAATCAACCTCTAATCAAGGAGCTGATGAGTTCTGGAATGAAGTTCAGATGCTTTCTAAATTAAGACACTG...

Protein

Download Protein FASTA

634 aa · TkA01G545270|TK1151|PROTEIN

MAAETSSSLELPQQCRQFTISEIHLATRNFDESLVIGRGGFGMVYKGTITNGTTQLVVAIKRLESTSNQGADEFWNEVQMLSKLRHCHLVSLIGYCKDAQEMILVYEYIPHGTLEDHLHKLHTPFTWVLRLKICIGVARALDYLHTGTGIKLGIIHRDVKSSNILLDDSWAAKISDFGLSKVGPINQAATHVNTLVKGTFGYLDPDYYATGRLTRKSDVYAFGVVLLEVLSGKQAVDRSLDEEHWGLVNWAQESIKEGRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G545270
TK1151 IDTkA01G545270
OH-1004 IDLXL04_001341
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)77.400
Protein coverage (%)TK1151 96.530 / OH-1004 93.413
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G545270
LocationChr01:136844843-136851115 (+)
DescriptionSimilar to ANX2: Receptor-like protein kinase ANXUR2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g38990 Probable receptor-like protein kinase At5g38990. No verified direct reference in this release
At5g39000 Putative receptor-like protein kinase At5g39000. No verified direct reference in this release
At3g51550 May regulate MLO7 polarization in female gametophyte synergid cells to control pollen tube growth and male gamete delivery during fertilization.
FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development.2010 · DOI: 10.1073/pnas.1005366107
At5g28680 Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell. No verified direct reference in this release
At3g04690 Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001341 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0010038 response to metal ion Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009536 plastid Cellular Component
GO:0016324 apical plasma membrane Cellular Component
GO:0090404 pollen tube tip Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0004714 transmembrane receptor protein tyrosine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference
ath:AT5G28680
ath:AT5G38990
ath:AT5G39000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.582
Rank 1 · TkA01G545270 · TK1151
Cytoplasm0.344
Rank 2 · TkA01G545270 · TK1151
Nucleus0.232
Rank 3 · TkA01G545270 · TK1151
Endoplasmic reticulum0.041
Rank 4 · TkA01G545270 · TK1151
Golgi apparatus0.035
Rank 5 · TkA01G545270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05690ThiG25-81 aa
PF07714PK_Tyr_Ser-Thr35-305 aa
PF00069Pkinase35-302 aa
PF01636APH55-119 aa
PF06293Kdo111-169 aa
PF14531Kinase-like130-183 aa
PF01636APH151-185 aa
PF07714PK_Tyr_Ser-Thr389-600 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G545270PF05690ThiG25810.3710.8
TkA01G545270PF07714PK_Tyr_Ser-Thr353053.4e-75253.4
TkA01G545270PF00069Pkinase353022.3e-63214.7
TkA01G545270PF01636APH551190.03414.6
TkA01G545270PF06293Kdo1111690.1212.6
TkA01G545270PF14531Kinase-like1301830.001418.6
TkA01G545270PF01636APH1511850.03414.6
TkA01G545270PF07714PK_Tyr_Ser-Thr3896003.4e-75253.4
TkA01G545270PF00069Pkinase3895982.3e-63214.7
TkA01G545270PF06293Kdo4254810.1212.6
TkA01G545270PF14531Kinase-like4485160.001418.6
TkA01G545270PF01636APH4544780.03414.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FID9Arabidopsis thalianasp|Q9FID9|Y5389_ARATH Probable receptor-like protein kinase At5g3899052.100%Swiss-ProtMedium
Q9FID8Arabidopsis thalianasp|Q9FID8|Y5900_ARATH Putative receptor-like protein kinase At5g3900051.500%Swiss-ProtMedium
Q9SCZ4Arabidopsis thalianasp|Q9SCZ4|FERON_ARATH Receptor-like protein kinase FERONIA49.600%Swiss-ProtMedium
Q3E8W4Arabidopsis thalianasp|Q3E8W4|ANX2_ARATH Receptor-like protein kinase ANXUR254.000%Swiss-ProtHigh
Q9SR05Arabidopsis thalianasp|Q9SR05|ANX1_ARATH Receptor-like protein kinase ANXUR152.700%Swiss-ProtHigh

JBrowse

View in Genome Browser