TkA01G544280 | RubberDandelionOmics

Gene overview

TkA01G544280

Reference: TK1151 Chr: Chr01 Coordinates: 136531463-136533986 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2344 bp · TkA01G544280|TK1151|cDNA

ATAATTCTAGAAACAATGAGAAAGTCATCACAAATATCTGAAATTGTTTGTTACCCACAAAATGGACTAGATGAACCGGCAGAGGCATGGGGTGTCCAGGTACATCCCCTCTTACAGCTTCATCAAACGAACACGCCTTCTTCAATCTTCTCCATCGTCAATCGCCTCCATCGTCTATGCCCATTGTCCTCTCTCTTTCAGTTCATACTCCTCATTTACTCCTCCAAATTCATCCATAATTCGTCCTTAATTCATTTCCA...

CDS

Download CDS FASTA

2184 bp · TkA01G544280|TK1151|CDS

ATGAGAAAGTCATCACAAATATCTGAAATTGTTTGTTACCCACAAAATGGACTAGATGAACCGGCAGAGGCATGGGGTGTCCAGGTACATCCCCTCTTACAGCTTCATCAAACGAACACGCCTTCTTCAATCTTCTCCATCGTCAATCGCCTCCATCGTCTATGCCCATTGTCCTCTCTCTTTCAGTTCATACTCCTCATTTACTCCTCCAAATTCATCCATAATTCGTCCTTAATTCATTTCCAGAAAAAGGTTTTTGG...

Protein

Download Protein FASTA

727 aa · TkA01G544280|TK1151|PROTEIN

MRKSSQISEIVCYPQNGLDEPAEAWGVQVHPLLQLHQTNTPSSIFSIVNRLHRLCPLSSLFQFILLIYSSKFIHNSSLIHFQKKVFGFFSFRNPKSHVPASLLPITVAVIVSVIVTSLKTFFFLEAQKSKHMSRASRSDVSLGFFPHSSHHSHLSDESISFQIDSSFRSSSRHAVPLQLMEEQTTTKINSVDLNGKTKIGGEEDEEERDIDNFQILGHHMFLKRRRDDNSSGATPESSSSSSTSSKRCRTDQSGQERSLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G544280`
TK1151 ID	TkA01G544280
OH-1004 ID	LXL04_001354
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G544280

Location Chr01:136531463-136533986 (-)

Description Similar to SHM6: Serine hydroxymethyltransferase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g36370`	Catalyzes the interconversion of serine and glycine.	No verified direct reference in this release
`At1g22020`	Catalyzes the interconversion of serine and glycine.	No verified direct reference in this release
`At4g13930`	Catalyzes the interconversion of serine and glycine with the conversion of tetrahydrofolate (THF) into 5,10-methylene-THF.	No verified direct reference in this release
`At4g13890`	Catalyzes the interconversion of serine and glycine.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001354 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006730 one-carbon metabolic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009555 pollen development Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0019264 glycine biosynthetic process from L-serine Biological Process

GO:0035999 tetrahydrofolate interconversion Biological Process

GO:0046500 S-adenosylmethionine metabolic process Biological Process

GO:0046653 tetrahydrofolate metabolic process Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0055063 sulfate ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G22020

ath:AT1G36370

ath:AT4G13890

ath:AT4G13930

ddi:DDB_G0277947

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.364

Rank 1 · TkA01G544280 · TK1151

Nucleus0.304

Rank 2 · TkA01G544280 · TK1151

Plastid0.157

Rank 3 · TkA01G544280 · TK1151

Mitochondrion0.150

Rank 4 · TkA01G544280 · TK1151

Peroxisome0.065

Rank 5 · TkA01G544280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26327LpqS106-160 aa

PF30523DnaG_cyano_C263-341 aa

PF00464SHMT274-674 aa

PF01212Beta_elim_lyase448-592 aa

PF00266Aminotran_5461-600 aa

PF26327LpqS501-521 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G544280	`PF26327`	LpqS	106	160	0.12	13.3
TkA01G544280	`PF30523`	DnaG_cyano_C	263	341	0.19	13.3
TkA01G544280	`PF00464`	SHMT	274	674	9.1e-166	552.1
TkA01G544280	`PF01212`	Beta_elim_lyase	448	592	0.12	12.4
TkA01G544280	`PF00266`	Aminotran_5	461	600	0.00039	20.2
TkA01G544280	`PF26327`	LpqS	501	521	0.12	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WV0`	Arabidopsis thaliana	sp\|Q84WV0\|GLYC7_ARATH Serine hydroxymethyltransferase 7	65.400%	Swiss-Prot	High
`Q9LM59`	Arabidopsis thaliana	sp\|Q9LM59\|GLYC6_ARATH Serine hydroxymethyltransferase 6	64.200%	Swiss-Prot	High
`O23254`	Arabidopsis thaliana	sp\|O23254\|GLYC4_ARATH Serine hydroxymethyltransferase 4	62.700%	Swiss-Prot	Medium
`Q9SVM4`	Arabidopsis thaliana	sp\|Q9SVM4\|GLYC5_ARATH Serine hydroxymethyltransferase 5	61.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card