TkA01G542360 | RubberDandelionOmics

Gene overview

TkA01G542360

Reference: TK1151 Chr: Chr01 Coordinates: 136057221-136059612 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1382 bp · TkA01G542360|TK1151|cDNA

AACACATAACGGATGGGGAAAGTATATTTCTTCGAGATAATATTTAAGTTGATTTACCGGAGAAATAAACCAATGAAATCTTGAAACATAAAAAAAGAGGAAACCGTCAATTAAGAAATCTCCACGGCGGTTGTGTACAGTCGAAGGATTAGATCAAAACTCTGGTCCCGTAACTATATCTTTTCACTCCGATGGTTGGTTCGTTTGCGTATCAGCCACCGGATTTCTCCATATCCGGTCTCGGAGCAAGTTCCAAGCCT...

CDS

Download CDS FASTA

1017 bp · TkA01G542360|TK1151|CDS

ATGGTTGGTTCGTTTGCGTATCAGCCACCGGATTTCTCCATATCCGGTCTCGGAGCAAGTTCCAAGCCTTTCCATCTCATCACCAACGCCGCCGCTCTACGCCTTGGTCGCTTCCTTCGCCACAGTTTCGTCTCCCATCGCCATCACTTGGGGTCTATTCTACAATCATCTTCAAAGATTCCTCGATTTGGCCATCTTCTCCAGTTAAACGGAGTGTCTCAGGGAAAATCAGACCAATTTAATTGGTTCAAGTTTCCTCA...

Protein

Download Protein FASTA

338 aa · TkA01G542360|TK1151|PROTEIN

MVGSFAYQPPDFSISGLGASSKPFHLITNAAALRLGRFLRHSFVSHRHHLGSILQSSSKIPRFGHLLQLNGVSQGKSDQFNWFKFPQWPHDTWGTAFSSCLLFFGGDGNQPNLGDQEKAYLRTPTRGPVNRRRLTNILLAINVLAYAAQVASQGQLLMWGAKINGLIDKGQLWRLVTPAFLHANLGHLMINCYSLNSIGPTMEHLSGPTRYLTIYMASAISSSGMSYRFSKAPAVGASGAIFGLVGAFAIFVLRHNNMVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G542360`
TK1151 ID	TkA01G542360
OH-1004 ID	LXL04_001370
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G542360

Location Chr01:136057221-136059612 (+)

Description Similar to RBL10: RHOMBOID-like protein 10, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g25290`	Rhomboid-type serine protease that catalyzes intramembrane proteolysis.	Rhomboid proteins in the chloroplast envelope affect the level of allene oxide synthase in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1365-313x.2012.05090.x
`At2g29050`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At4g23070`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At1g52580`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001370 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006654 phosphatidic acid biosynthetic process Biological Process

GO:0019374 galactolipid metabolic process Biological Process

GO:0046473 phosphatidic acid metabolic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0004252 serine-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G25290

ath:AT1G63120

ath:AT5G38510

bsu:BSU04610

bsu:BSU24870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.781

Rank 1 · TkA01G542360 · TK1151

Mitochondrion0.193

Rank 2 · TkA01G542360 · TK1151

Nucleus0.032

Rank 3 · TkA01G542360 · TK1151

Cytoplasm0.027

Rank 4 · TkA01G542360 · TK1151

Cell membrane0.012

Rank 5 · TkA01G542360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08551DUF1751155-223 aa

PF04511DER1162-204 aa

PF01694Rhomboid169-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G542360	`PF08551`	DUF1751	155	223	0.0091	16.1
TkA01G542360	`PF04511`	DER1	162	204	0.1	13.3
TkA01G542360	`PF01694`	Rhomboid	169	306	1e-37	130.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4ICF4`	Arabidopsis thaliana	sp\|F4ICF4\|RBL10_ARATH RHOMBOID-like protein 10, chloroplastic	57.900%	Swiss-Prot	Medium
`Q0WQX7`	Arabidopsis thaliana	sp\|Q0WQX7\|RBL1_ARATH RHOMBOID-like protein 1	34.400%	Swiss-Prot	Low
`O82756`	Arabidopsis thaliana	sp\|O82756\|RBL7_ARATH RHOMBOID-like protein 7	36.000%	Swiss-Prot	Low
`Q9SSR0`	Arabidopsis thaliana	sp\|Q9SSR0\|RBL5_ARATH RHOMBOID-like protein 5	30.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card