TkA01G539310 | RubberDandelionOmics

Gene overview

TkA01G539310

Reference: TK1151 Chr: Chr01 Coordinates: 135221124-135224159 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1572 bp · TkA01G539310|TK1151|cDNA

TTAGGAGGTTCCTCGGACAACAGGTGACCAAAATCAGGGGCTATTTACTTTTGTGATCCTCACAAAAGCAGATACACCCCCCATTATAGACCCTAAAAATGGAGCTAAGAATGATGAAAATACAGCTGTAATAGCTTCCAGAATTCTTCTCTCTCTGTCTGACTTGGTGTGTTTCTTCGCATTATTATACAACCATATATAAAAGCAATAAAGCCATAAATTAGAAATAGAAAGTCAAAATAAGGGGCATAGTCTCAGCA...

CDS

Download CDS FASTA

843 bp · TkA01G539310|TK1151|CDS

ATGGGTAATTTATGCAGCAATTCCGGTTCCAAGCTTGCAAATGGGCAATCATCAAATGGTGCGGGAAAAGGGCGGGGAAATCAAGGGTCAATTAGATACGGGTTCACTCTAGTCAAAGGGAAAGCAAATCATCCAATGGAAGATTACCATGTTGCCAAATTTGTCCCTCATCAAGGACGCGAACTTGGACTTTTTGCTATTTACGACGGCCATCTTGGTGACACTGTGCCGTCGTATCTTCAAAAACATTTATTCTCCAA...

Protein

Download Protein FASTA

280 aa · TkA01G539310|TK1151|PROTEIN

MGNLCSNSGSKLANGQSSNGAGKGRGNQGSIRYGFTLVKGKANHPMEDYHVAKFVPHQGRELGLFAIYDGHLGDTVPSYLQKHLFSNILKEGEFWTDPNRSISKAYERTDQAILSHNPDLGRGGSTAVTAILINGQKLWVANVGDSRAVLSQKGQAIQMSIDHEPNTERGSIENRGGFVSNMPGDVARVNGQLAVSRAFGDKNLKNHLRSDPDVTNADIDADTDILILASDGLWKVMSNQEAVDVAIKIRDPQKAAKQLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G539310`
TK1151 ID	TkA01G539310
OH-1004 ID	LXL04_001415
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G539310

Location Chr01:135221124-135224159 (-)

Description Similar to At1g34750: Probable protein phosphatase 2C 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22280`	Involved in the regulation of phytochrome signaling.	No verified direct reference in this release
`At1g34750`	Probable protein phosphatase 2C 10.	No verified direct reference in this release
`At1g78200`	Probable protein phosphatase 2C 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q7XQU7`	Probable protein phosphatase 2C 41.	No verified direct reference in this release
`Os04g0609600`	Probable protein phosphatase 2C 44.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001415 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0010161 red light signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004721 phosphoprotein phosphatase activity Molecular Function

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G22280

ath:AT1G34750

ath:AT1G78200

dosa:Os04g0451900

dosa:Os04g0609600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.500

Rank 1 · TkA01G539310 · TK1151

Nucleus0.340

Rank 2 · TkA01G539310 · TK1151

Cell membrane0.216

Rank 3 · TkA01G539310 · TK1151

Lysosome / Vacuole0.100

Rank 4 · TkA01G539310 · TK1151

Endoplasmic reticulum0.077

Rank 5 · TkA01G539310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C41-272 aa

PF07228SpoIIE101-155 aa

PF07228SpoIIE223-279 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G539310	`PF00481`	PP2C	41	272	5.3e-57	194.1
TkA01G539310	`PF07228`	SpoIIE	101	155	0.0051	17.5
TkA01G539310	`PF07228`	SpoIIE	223	279	0.0051	17.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LME4`	Arabidopsis thaliana	sp\|Q9LME4\|P2C09_ARATH Probable protein phosphatase 2C 9	73.100%	Swiss-Prot	High
`Q9S9Z7`	Arabidopsis thaliana	sp\|Q9S9Z7\|P2C10_ARATH Probable protein phosphatase 2C 10	75.700%	Swiss-Prot	High
`Q8L7I4`	Arabidopsis thaliana	sp\|Q8L7I4\|P2C17_ARATH Probable protein phosphatase 2C 17	66.900%	Swiss-Prot	High
`Q7XQU7`	Oryza sativa subsp. japonica	sp\|Q7XQU7\|P2C41_ORYSJ Probable protein phosphatase 2C 41	69.300%	Swiss-Prot	High
`Q0JAA0`	Oryza sativa subsp. japonica	sp\|Q0JAA0\|P2C44_ORYSJ Probable protein phosphatase 2C 44	60.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card