TkA01G528690 | RubberDandelionOmics

Gene overview

TkA01G528690

Reference: TK1151 Chr: Chr01 Coordinates: 132703893-132705916 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1545 bp · TkA01G528690|TK1151|cDNA

CAAGTATTACCCAAAAGCAGCGTGCCACGTGCTTGACGCAGACAATTTCTACTCTTATTCTTCCTCAATTCTGTTTCTACGCAGTTTCATGCCTTTTCTGTAAAACAACTTCCATCTCCAACGGAATTTTCACACCAGCAGACAGCAGTCCGATCGGAAAAATATGACGACGGATGGGTTCCGGGTACTGGACGTGAAGTCGTTGACGGAATATATCAAAGCCACGCCATCTTTAGCTTCAAAGCTGGGGGATGAACTTG...

CDS

Download CDS FASTA

1248 bp · TkA01G528690|TK1151|CDS

ATGACGACGGATGGGTTCCGGGTACTGGACGTGAAGTCGTTGACGGAATATATCAAAGCCACGCCATCTTTAGCTTCAAAGCTGGGGGATGAACTTGATAACTTGGAAATCAAAGAAGTTGGAGACGGGAATCTTAATTTCGTATACATCATCATCTCTACATCTGGCTCCCTTGTCATTAAACAGGCTGTGCCATACATCCGATTAATCGGCGAATCATGGCCAATGACCAAAGAAAGATCGTACTTCGAAGCCACAGC...

Protein

Download Protein FASTA

415 aa · TkA01G528690|TK1151|PROTEIN

MTTDGFRVLDVKSLTEYIKATPSLASKLGDELDNLEIKEVGDGNLNFVYIIISTSGSLVIKQAVPYIRLIGESWPMTKERSYFEATALKRQHSLSPNHVPEVYHFDRTMSLIGMRYIEPPHIILRKGLIAGVEYPLLAEHMAEFMANTLFYTSLLHLTTTQHKSAVAEFCANVELCRLTEQVVFSDPYKISEFNRWTSPYLDSDAESIRNDKILKLEVAELKSKFCEKAQALIHGDLHTSSVMVTKESTQVIDPEFAFYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G528690`
TK1151 ID	TkA01G528690
OH-1004 ID	LXL04_001525
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G528690

Location Chr01:132703893-132705916 (-)

Description Similar to MTK: Methylthioribose kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49820`	Catalyzes the phosphorylation of methylthioribose into methylthioribose-1-phosphate in the methionine cycle.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0669900`	Catalyzes the phosphorylation of methylthioribose into methylthioribose-1-phosphate.	No verified direct reference in this release
`Os04g0669800`	Catalyzes the phosphorylation of methylthioribose into methylthioribose-1-phosphate.	Functional analysis of methylthioribose kinase genes in plants.2004 · DOI: 10.1104/pp.104.053587

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001525 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0019509 L-methionine salvage from methylthioadenosine Biological Process

GO:0005524 ATP binding Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046522 S-methyl-5-thioribose kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G49820

dosa:Os04g0669800

ecz:ECS88_4901

gwc:GWCH70_0847

osa:107276080

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.737

Rank 1 · TkA01G528690 · TK1151

Nucleus0.333

Rank 2 · TkA01G528690 · TK1151

Mitochondrion0.095

Rank 3 · TkA01G528690 · TK1151

Cell membrane0.055

Rank 4 · TkA01G528690 · TK1151

Peroxisome0.054

Rank 5 · TkA01G528690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03881Fructosamin_kin24-61 aa

PF01636APH36-270 aa

PF01633Choline_kinase201-290 aa

PF02958EcKL223-270 aa

PF03881Fructosamin_kin228-268 aa

PF04655APH_6_hur229-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G528690	`PF03881`	Fructosamin_kin	24	61	0.048	13.6
TkA01G528690	`PF01636`	APH	36	270	2.2e-11	44.7
TkA01G528690	`PF01633`	Choline_kinase	201	290	0.0011	19.1
TkA01G528690	`PF02958`	EcKL	223	270	0.11	12.5
TkA01G528690	`PF03881`	Fructosamin_kin	228	268	0.048	13.6
TkA01G528690	`PF04655`	APH_6_hur	229	269	0.004	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C6D2`	Arabidopsis thaliana	sp\|Q9C6D2\|MTK_ARATH Methylthioribose kinase	69.100%	Swiss-Prot	High
`Q7XR60`	Oryza sativa subsp. japonica	sp\|Q7XR60\|MTK2_ORYSJ Methylthioribose kinase 2	69.300%	Swiss-Prot	High
`Q7XR61`	Oryza sativa subsp. japonica	sp\|Q7XR61\|MTK1_ORYSJ Methylthioribose kinase 1	69.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card