TkA01G524650 | RubberDandelionOmics

Gene overview

TkA01G524650

Reference: TK1151 Chr: Chr01 Coordinates: 131705553-131708990 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2871 bp · TkA01G524650|TK1151|cDNA

GAAAAAGAAAAGTTGCATGGATTCTTGAATTGAAGTTTATTCTAAAATTCCACAGCTCTGCAACACTGAAACCACTTTCATTGTCCCTAATCTCCCATGACCTTTTTGTTCACCAGAACAACAATGGCGACAGTTGTTTACCCTCTCTTTCCCTTTTCATCACCTAAATATCCCTCTCTTTACACCCCTTAATCTTAACATTCTCATTAGCAACCAATCATGACCACACTCCTCCATTTCTTCTTCCCATTTGCTCTGTT...

CDS

Download CDS FASTA

2352 bp · TkA01G524650|TK1151|CDS

ATGACCACACTCCTCCATTTCTTCTTCCCATTTGCTCTGTTTATTTCTTCATTCTCTGCTTTGAACTCTGATGGAATCCTTCTTCTCTCTTTCAAATACTCTGTTCTCTCTGACCCACTTTCAGTTCTTGATAACTGGAACTACGATGATCCAACTCCGTGTGCATGGAGAGGTGTCACCTGTGAAGATTCATCCAGGTCGGGTACGCCAGAGTCATTCAACGTCGTCAGCTTGGTTCTTCCCGGTTCTCACCTTCTTGG...

Protein

Download Protein FASTA

783 aa · TkA01G524650|TK1151|PROTEIN

MTTLLHFFFPFALFISSFSALNSDGILLLSFKYSVLSDPLSVLDNWNYDDPTPCAWRGVTCEDSSRSGTPESFNVVSLVLPGSHLLGSIPQDLGMIPHLRSLDLSDNSLNGSLPPSIFNSSELESLSLSSNVIAGDLPESIAGLRSLKVLNLSDNAFAGKLPESLASMKNLTSISLKNNYFSGSVPGGFDDVEVLDLSFNLFNETLPLDFGGEKLRYLNLSNNKLSGSVSTGFAGKIQANATIDLSFNNLTGEIPQVVSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G524650`
TK1151 ID	TkA01G524650
OH-1004 ID	LXL04_001575
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G524650

Location Chr01:131705553-131708990 (-)

Description Similar to At4g37250: Probable LRR receptor-like serine/threonine-protein kinase At4g37250

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34220`	Receptor protein kinase-like protein At4g34220.	No verified direct reference in this release
`At4g37250`	Probable LRR receptor-like serine/threonine-protein kinase At4g37250.	No verified direct reference in this release
`At2g01210`	Receptor protein kinase acting as an integrator for intracellular calcium and heterotrimeric G protein signaling with extracellular signals during early zygote development.	No verified direct reference in this release
`At1g66830`	Probable inactive leucine-rich repeat receptor-like protein kinase At1g66830.	No verified direct reference in this release
`At3g56100`	Can phosphorylate AGL24.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001575 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0010069 zygote asymmetric cytokinesis in embryo sac Biological Process

GO:0010070 zygote asymmetric cell division Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0062207 regulation of pattern recognition receptor signaling pathway Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G48480

ath:AT1G66830

ath:AT2G01210

ath:AT4G34220

ath:AT4G37250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.877

Rank 1 · TkA01G524650 · TK1151

Endoplasmic reticulum0.081

Rank 2 · TkA01G524650 · TK1151

Cytoplasm0.068

Rank 3 · TkA01G524650 · TK1151

Nucleus0.057

Rank 4 · TkA01G524650 · TK1151

Lysosome / Vacuole0.020

Rank 5 · TkA01G524650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_221-61 aa

PF23211LRR_LRWD166-132 aa

PF00560LRR_175-94 aa

PF13855LRR_875-133 aa

PF12799LRR_487-112 aa

PF23598LRR_1491-177 aa

PF29594LRR_SKP293-168 aa

PF24048LRR_NXF1-595-127 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G524650	`PF08263`	LRRNT_2	21	61	3.1e-11	44.1
TkA01G524650	`PF23211`	LRR_LRWD1	66	132	0.0017	18.8
TkA01G524650	`PF00560`	LRR_1	75	94	5.9e-21	70.8
TkA01G524650	`PF13855`	LRR_8	75	133	9.8e-15	54.8
TkA01G524650	`PF12799`	LRR_4	87	112	3.6e-10	40.5
TkA01G524650	`PF23598`	LRR_14	91	177	8.3e-08	32.1
TkA01G524650	`PF29594`	LRR_SKP2	93	168	1.0	9.3
TkA01G524650	`PF24048`	LRR_NXF1-5	95	127	0.11	12.9
TkA01G524650	`PF13855`	LRR_8	97	156	9.8e-15	54.8
TkA01G524650	`PF12799`	LRR_4	97	133	3.6e-10	40.5
TkA01G524650	`PF13516`	LRR_6	97	110	0.00031	21.3
TkA01G524650	`PF00560`	LRR_1	98	119	5.9e-21	70.8
TkA01G524650	`PF24048`	LRR_NXF1-5	119	172	0.11	12.9
TkA01G524650	`PF12799`	LRR_4	122	155	3.6e-10	40.5
TkA01G524650	`PF00560`	LRR_1	123	144	5.9e-21	70.8
TkA01G524650	`PF13516`	LRR_6	123	134	0.00031	21.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94C77`	Arabidopsis thaliana	sp\|Q94C77\|RPKL_ARATH Receptor protein kinase-like protein At4g34220	51.300%	Swiss-Prot	High
`C0LGS3`	Arabidopsis thaliana	sp\|C0LGS3\|Y4372_ARATH Probable LRR receptor-like serine/threonine-protein kinase At4g37250	50.000%	Swiss-Prot	High
`Q9ZU46`	Arabidopsis thaliana	sp\|Q9ZU46\|ZAR1_ARATH Receptor protein kinase-like protein ZAR1	39.000%	Swiss-Prot	Medium
`Q9C9N5`	Arabidopsis thaliana	sp\|Q9C9N5\|Y1668_ARATH Probable inactive leucine-rich repeat receptor-like protein kinase At1g66830	36.900%	Swiss-Prot	Low
`C0LGP9`	Arabidopsis thaliana	sp\|C0LGP9\|IMK3_ARATH Probable leucine-rich repeat receptor-like protein kinase IMK3	32.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card