TkA01G523300 | RubberDandelionOmics

Gene overview

TkA01G523300

Reference: TK1151 Chr: Chr01 Coordinates: 131356870-131357940 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1020 bp · TkA01G523300|TK1151|cDNA

ATGTTTTATCCATGGAGTACTGATCTCGCAGCCAAATTCAACATCCCCAGAATCGTTTTTAGTGGAAGTGGCTTCTTCCCGCTTTGCATTGCTAACTCTATTGGACACTCTCGACATCCCAAAAATATTTCTTCAGAATCGGAATCTTTTATCGTCCCACATCTTCCCCATGAGATAAAGTTAACCAGAAAGCAACTGCCTAATTTCGAGGTAGAAGCCTTTAAAGGTTTATTGAAGGTGTTAACAGAAGCAATGGAAGC...

CDS

Download CDS FASTA

1020 bp · TkA01G523300|TK1151|CDS

ATGTTTTATCCATGGAGTACTGATCTCGCAGCCAAATTCAACATCCCCAGAATCGTTTTTAGTGGAAGTGGCTTCTTCCCGCTTTGCATTGCTAACTCTATTGGACACTCTCGACATCCCAAAAATATTTCTTCAGAATCGGAATCTTTTATCGTCCCACATCTTCCCCATGAGATAAAGTTAACCAGAAAGCAACTGCCTAATTTCGAGGTAGAAGCCTTTAAAGGTTTATTGAAGGTGTTAACAGAAGCAATGGAAGC...

Protein

Download Protein FASTA

339 aa · TkA01G523300|TK1151|PROTEIN

MFYPWSTDLAAKFNIPRIVFSGSGFFPLCIANSIGHSRHPKNISSESESFIVPHLPHEIKLTRKQLPNFEVEAFKGLLKVLTEAMEAEAKSYGVIFNSFYELEREYVHHYREVMKRKCWHIGPVSLCNTEDKSERMKKSVIEEYECRKWLETKTPDSVVYVSFGTLVKVTRNQVYEIAMGLEACNESFIWVIKNEHEQWMPEGFEKRTTASGKGWAPQWNSVLEGVTGGVAMVAWPVMAEQFYNAKLVTDVLGIGVSIGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G523300`
TK1151 ID	TkA01G523300
OH-1004 ID	LXL04_001590
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.000
Protein coverage (%)	TK1151 100.000 / OH-1004 75.260 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G523300

Location Chr01:131356870-131357940 (+)

Description Similar to TOGT1: Scopoletin glucosyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34135`	Catalyzes the glycosylation of flavonoids from UDP-glucose.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001590 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0016104 triterpenoid biosynthetic process Biological Process

GO:0016135 saponin biosynthetic process Biological Process

GO:0051555 flavonol biosynthetic process Biological Process

GO:0051707 response to other organism Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0033836 flavonol 7-O-beta-glucosyltransferase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0047893 flavonol 3-O-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G34131

ath:AT4G34135

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.817

Rank 1 · TkA01G523300 · TK1151

Nucleus0.200

Rank 2 · TkA01G523300 · TK1151

Endoplasmic reticulum0.058

Rank 3 · TkA01G523300 · TK1151

Cell membrane0.051

Rank 4 · TkA01G523300 · TK1151

Peroxisome0.046

Rank 5 · TkA01G523300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N72-124 aa

PF00201UDPGT106-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G523300	`PF26168`	Glyco_transf_N	72	124	0.014	16.1
TkA01G523300	`PF00201`	UDPGT	106	251	7.9e-08	32.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94C57`	Arabidopsis thaliana	sp\|Q94C57\|U73B2_ARATH UDP-glucosyl transferase 73B2	43.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card