TkA01G522970 | RubberDandelionOmics

Gene overview

TkA01G522970

Reference: TK1151 Chr: Chr01 Coordinates: 131230253-131235129 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3661 bp · TkA01G522970|TK1151|cDNA

TTGCCATATCATCAGCGTACCTGGATCGTAAATAAAATAAAAGGTAAGGGCATAAACCTAATTAACGCAATTTCCATCATCGATCCCCACAACTTTCGTTCTCGTAACCGTCTCGCTCCGATTCCAGCCTCCATCGCCATCACAGAGAGAGGATCTCGAGTAGAGGAGAGGGAATCTCGCCTGAAATCTTACGTACTTCTGCCAAGAGATGGCGAACGAACAACCGGTTCTGCCGGCAGACGACAGAGTGCGAGATGTCG...

CDS

Download CDS FASTA

3162 bp · TkA01G522970|TK1151|CDS

ATGGCGAACGAACAACCGGTTCTGCCGGCAGACGACAGAGTGCGAGATGTCGCTGTCAATGCGCCAGTTTCTTCATCTTCTTCATCATCGGGATCTTCTGCTTCGATTTTAACATCAGAGAGTGTTTCGGATAATGCTAATAACGGAAAGAATTTATCGAACACCATGTATGATGATGACGATGACGAAGAGGGGGATGTTTGCCGGATCTGCCGGAATCCGGGAGACGCCGATAATCCTCTACGGTATCCTTGTGCTTG...

Protein

Download Protein FASTA

1053 aa · TkA01G522970|TK1151|PROTEIN

MANEQPVLPADDRVRDVAVNAPVSSSSSSSGSSASILTSESVSDNANNGKNLSNTMYDDDDDEEGDVCRICRNPGDADNPLRYPCACSGSIKFVHQDCLLQWLNHSNARQCEVCKHPFSFSPVYAENAPAKLPFQEFVVGMSMKACHILQFFLRLTFVLSVWLVIIPFITFWIWRFSFVRTFKEAQKLFLTHISTTIILTDCLHGFLLSASIVFIFLGATSLRDYFRHLREIGGQEGNIDDEGDRNGARAARRQAQQPQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G522970`
TK1151 ID	TkA01G522970
OH-1004 ID	LXL04_001598
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 94.360 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G522970

Location Chr01:131230253-131235129 (+)

Description Similar to SUD1: Probable E3 ubiquitin ligase SUD1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34100`	Probable E3 ubiquitin ligase acting as a positive post-transcriptional regulator of 3-hydroxy-3-methylglutaryl-coenzyme A reductase activity.	Arabidopsis ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status.2012 · DOI: 10.1104/pp.112.198697 The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108696

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001598 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008299 isoprenoid biosynthetic process Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045541 negative regulation of cholesterol biosynthetic process Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

GO:1900486 positive regulation of isopentenyl diphosphate biosynthetic process, mevalonate pathway Biological Process

KEGG gene cross-reference

ath:AT4G34100

hsa:10299

mmu:223455

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.635

Rank 1 · TkA01G522970 · TK1151

Nucleus0.164

Rank 2 · TkA01G522970 · TK1151

Golgi apparatus0.156

Rank 3 · TkA01G522970 · TK1151

Cytoplasm0.111

Rank 4 · TkA01G522970 · TK1151

Cell membrane0.077

Rank 5 · TkA01G522970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639zf-RING_267-115 aa

PF12861zf-ANAPC1167-120 aa

PF12906RINGv68-114 aa

PF23113MARCHF6_C146-170 aa

PF23113MARCHF6_C352-373 aa

PF23113MARCHF6_C451-472 aa

PF23113MARCHF6_C509-577 aa

PF23113MARCHF6_C781-781 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G522970	`PF13639`	zf-RING_2	67	115	0.011	16.7
TkA01G522970	`PF12861`	zf-ANAPC11	67	120	0.079	13.7
TkA01G522970	`PF12906`	RINGv	68	114	6.4e-17	62.1
TkA01G522970	`PF23113`	MARCHF6_C	146	170	2.7e-48	164.8
TkA01G522970	`PF23113`	MARCHF6_C	352	373	2.7e-48	164.8
TkA01G522970	`PF23113`	MARCHF6_C	451	472	2.7e-48	164.8
TkA01G522970	`PF23113`	MARCHF6_C	509	577	2.7e-48	164.8
TkA01G522970	`PF23113`	MARCHF6_C	781	781	2.7e-48	164.8
TkA01G522970	`PF23113`	MARCHF6_C	849	1026	2.7e-48	164.8
TkA01G522970	`PF13639`	zf-RING_2	1008	1015	0.011	16.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JKK0`	Arabidopsis thaliana	sp\|F4JKK0\|SUD1_ARATH Probable E3 ubiquitin ligase SUD1	73.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card