TkA01G520160 | RubberDandelionOmics

Gene overview

TkA01G520160

Reference: TK1151 Chr: Chr01 Coordinates: 130385267-130390956 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3748 bp · TkA01G520160|TK1151|cDNA

AAAACAATGAACGAAACGGATTGAATTCCATTTCTTTCGCTTAGAGATTCTAATTCGTTTAAGATTCTATATCTTTACAAATCACAAGCTGTTCAACGTCAGAAAAATTAGGACCATCAACACCCAGGTCAGCTTTCAAAGATAACGCAGTCGATCGAAATCGAACAAGACAACCACGCCGATCCTTTAATTATTATTCAATTCATCAGTACAGCTCCGCCTAGCATGTTCTGTTCATCAACCAACTGAAGGCGATTGCA...

CDS

Download CDS FASTA

2265 bp · TkA01G520160|TK1151|CDS

ATGGGGGCGGTTTTAGCGGTAGTGCTAAAACCACGTGAAGCTCAATCACCTTTAGTTAGATGCATAGCTAGAGAGCTTTTAACAAATTTGGTAATGGAACCTGTAATGAGATTTGCAAGCCCTGGGTACATCAATGAATTACTTGAGCTTATTTTCCTCACATCCACCAACAATGGAGGTCAAGAACAATCACCAAATGTTCAAGATCATAAACAAGATCAATCCACAACCACAAAAAAATCCGATCTTTCTCATACCCA...

Protein

Download Protein FASTA

754 aa · TkA01G520160|TK1151|PROTEIN

MGAVLAVVLKPREAQSPLVRCIARELLTNLVMEPVMRFASPGYINELLELIFLTSTNNGGQEQSPNVQDHKQDQSTTTKKSDLSHTQKTDTTTTTTTTTTSRHDAQIELPLTLIQEKEKTKNLPAADWARVLEAATQRRTEVLQPENLENMWTKGRNYKKKAQKNAAKGQNGNIKKDKDKIETSSSEKFPPRPHNTDLSNSLSLDGGFEGSSSKVKFRKSNSASDLIKETRVETGYPGQVSGSIISEFYSANVGRHDVPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G520160`
TK1151 ID	TkA01G520160
OH-1004 ID	LXL04_001662
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	97.200
Protein coverage (%)	TK1151 99.469 / OH-1004 76.273 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G520160`
Location	Chr01:130385267-130390956 (+)
Description	Similar to SNX16: Sorting nexin-16
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001662` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001881 receptor recycling Biological Process GO:0006622 protein targeting to lysosome Biological Process GO:0008333 endosome to lysosome transport Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0045022 early endosome to late endosome transport Biological Process GO:0005764 lysosome Cellular Component GO:0005769 early endosome Cellular Component GO:0005770 late endosome Cellular Component GO:0010008 endosome membrane Cellular Component GO:0031410 cytoplasmic vesicle Cellular Component GO:0031901 early endosome membrane Cellular Component GO:0031902 late endosome membrane Cellular Component
KEGG gene cross-reference	hsa:64089 mmu:74718 pon:100173483 rno:64088 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.301

Rank 1 · TkA01G520160 · TK1151

Golgi apparatus0.287

Rank 2 · TkA01G520160 · TK1151

Cytoplasm0.277

Rank 3 · TkA01G520160 · TK1151

Cell membrane0.217

Rank 4 · TkA01G520160 · TK1151

Nucleus0.146

Rank 5 · TkA01G520160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02194PXA3-49 aa

PF08628Nexin_C43-79 aa

PF08628Nexin_C144-166 aa

PF00787PX306-382 aa

PF08628Nexin_C580-716 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G520160	`PF02194`	PXA	3	49	1.7e-08	35.6
TkA01G520160	`PF08628`	Nexin_C	43	79	1.2e-25	90.7
TkA01G520160	`PF08628`	Nexin_C	144	166	1.2e-25	90.7
TkA01G520160	`PF00787`	PX	306	382	3.8e-14	53.7
TkA01G520160	`PF08628`	Nexin_C	580	716	1.2e-25	90.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card