TkA01G518370 | RubberDandelionOmics

Gene overview

TkA01G518370

Reference: TK1151 Chr: Chr01 Coordinates: 129936810-129940844 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1681 bp · TkA01G518370|TK1151|cDNA

AAACTCCTCACACAAATTATCAGCTCCTTTTCTGCTTGCGTCTTCTCTTTATAACAAACAGTACCTATTAGAAGCATCTTTATACTTTATTAAATTTCTTCGTCGTTAATTTATCATGATTCATGAACATTTCGGCATTGAGCGCCTCATCTGCTCGCTCGCCGCTGAAACATGCTCGAAATTAATGCCATCGCCATTAATTTGTTTTTCTGCACAATGAGAAACTACCTTCTCCAATCGTCGCTGATGAGAACTGACTA...

CDS

Download CDS FASTA

684 bp · TkA01G518370|TK1151|CDS

ATGTGCAAAAGTCTTTTGATGATCTCAACAATTGGAGGGAGGAATTCCTTATTCAGACGTAAATGTTTGGTGTATCATATTGAACCTGGATCTCGAGTGGTGTGTGAAAGAGTTCAAATTAATGGGCTATCAAGGTTTAAAAACCTCAACAATTTATTCTCTTCGGGGAGGGTGAAGGTATATAACAAAAATACCAATGTTCATTCTCCAAACATAAGCATCTGTTTTCATAGGAATGCATCTCTTGCTGTATGCATGTG...

Protein

Download Protein FASTA

227 aa · TkA01G518370|TK1151|PROTEIN

MCKSLLMISTIGGRNSLFRRKCLVYHIEPGSRVVCERVQINGLSRFKNLNNLFSSGRVKVYNKNTNVHSPNISICFHRNASLAVCMCSEGQWNLIETGLDPCPLSVTSFWIYDLLFLINPCSTRDCYLVIQKVKSKYRLFYLVTGILLMSFATPLSNSYIVYYGVAMTMGFILVALVIFSQLRLCPKFKLKKVGMGSFSFGYIPTIFYLPLAKVGISEDVYSPVSLY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G518370`
TK1151 ID	TkA01G518370
OH-1004 ID	LXL04_001693
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.800
Protein coverage (%)	TK1151 87.665 / OH-1004 36.945 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G518370`
Location	Chr01:129936810-129940844 (+)
Description	Similar to bVPE: Vacuolar-processing enzyme beta-isozyme
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001693` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006624 vacuolar protein processing Biological Process GO:0051603 proteolysis involved in protein catabolic process Biological Process GO:0000326 protein storage vacuole Cellular Component GO:0005773 vacuole Cellular Component GO:0004197 cysteine-type endopeptidase activity Molecular Function
KEGG gene cross-reference	ath:AT1G62710 gmx:547964 rcu:8272115 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.568

Rank 1 · TkA01G518370 · TK1151

Nucleus0.166

Rank 2 · TkA01G518370 · TK1151

Cytoplasm0.143

Rank 3 · TkA01G518370 · TK1151

Golgi apparatus0.135

Rank 4 · TkA01G518370 · TK1151

Cell membrane0.111

Rank 5 · TkA01G518370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04920BNYVV_p3130-73 aa

PF04920BNYVV_p3183-96 aa

PF04920BNYVV_p31112-134 aa

PF10225NEMP135-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G518370	`PF04920`	BNYVV_p31	30	73	0.088	13.6
TkA01G518370	`PF04920`	BNYVV_p31	83	96	0.088	13.6
TkA01G518370	`PF04920`	BNYVV_p31	112	134	0.088	13.6
TkA01G518370	`PF10225`	NEMP	135	201	1.2e-07	32.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card