TkA01G515280 | RubberDandelionOmics

Gene overview

TkA01G515280

Reference: TK1151 Chr: Chr01 Coordinates: 129120027-129121175 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

955 bp · TkA01G515280|TK1151|cDNA

AATTACTCTAGAAATTTTTTCGAAAGTCCTGCCCTGAACATCAACACCTCCACTCCACCCACATGCACAGACATATTGCGATCTGCGACTATCAGCAAGAGCCCAACAATGGCGATAGAAGAAAAGGTGATTCTGCTGGATTTCTGGCCAAGCATGTTTGGGATGAGGACCAGGATAGCACTTGCAGAAAAGGGTGTTTTATATGAATACAGAGAAGAGAATTTGAAAAACAAGAGCGAGCTTCTCTTGAAGATGAACCC...

CDS

Download CDS FASTA

720 bp · TkA01G515280|TK1151|CDS

AATTACTCTAGAAATTTTTTCGAAAGTCCTGCCCTGAACATCAACACCTCCACTCCACCCACATGCACAGACATATTGCGATCTGCGACTATCAGCAAGAGCCCAACAATGGCGATAGAAGAAAAGGTGATTCTGCTGGATTTCTGGCCAAGCATGTTTGGGATGAGGACCAGGATAGCACTTGCAGAAAAGGGTGTTTTATATGAATACAGAGAAGAGAATTTGAAAAACAAGAGCGAGCTTCTCTTGAAGATGAACCC...

Protein

Download Protein FASTA

239 aa · TkA01G515280|TK1151|PROTEIN

NYSRNFFESPALNINTSTPPTCTDILRSATISKSPTMAIEEKVILLDFWPSMFGMRTRIALAEKGVLYEYREENLKNKSELLLKMNPIHKKIPVLIHNGKPICESSIIVEYIDEVWNDKSPLFPSDAYGKACARFWADFIDKKVEPNGRKLVFTKEGEEHEASRKEFIDSLKLIEGELGDKSYFGGESFGYVDVSLIAFSPWFHAYEIYGKLNIEQDCPKLIAWVKRCIQKKESVSSVC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G515280`
TK1151 ID	TkA01G515280
OH-1004 ID	LXL04_001748
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 97.071 / OH-1004 50.989 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G515280

Location Chr01:129120027-129121175 (-)

Description Similar to Probable glutathione S-transferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17180`	May be involved in the conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles and have a detoxification role against certain herbicides.	No verified direct reference in this release
`At1g78370`	Exhibits glutathione-dependent thiol transferase activities.	No verified direct reference in this release
`At1g78380`	Catalyzes the glutathionylation of 12-oxophytodienoate (OPDA).	Probing the diversity of the Arabidopsis glutathione S-transferase gene family.2002 · DOI: 10.1023/a:1015557300450 Organ-specific expression of glutathione S-transferases and the efficacy of herbicide safeners in Arabidopsis.2006 · DOI: 10.1104/pp.105.067199 Selective binding of glutathione conjugates of fatty acid derivatives by plant glutathione transferases.2009 · DOI: 10.1074/jbc.m109.020107

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001748 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006749 glutathione metabolic process Biological Process

GO:0009407 toxin catabolic process Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0046256 2,4,6-trinitrotoluene catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004364 glutathione transferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G17180

nta:107782951

nta:107823949

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.680

Rank 1 · TkA01G515280 · TK1151

Nucleus0.231

Rank 2 · TkA01G515280 · TK1151

Plastid0.112

Rank 3 · TkA01G515280 · TK1151

Peroxisome0.084

Rank 4 · TkA01G515280 · TK1151

Mitochondrion0.077

Rank 5 · TkA01G515280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02798GST_N42-114 aa

PF13417GST_N_351-114 aa

PF13409GST_N_251-114 aa

PF00043GST_C61-78 aa

PF00043GST_C155-230 aa

PF14497GST_C_3155-228 aa

PF13410GST_C_2159-227 aa

PF17171GST_C_6170-227 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G515280	`PF02798`	GST_N	42	114	4.1e-21	75.8
TkA01G515280	`PF13417`	GST_N_3	51	114	1.3e-13	51.8
TkA01G515280	`PF13409`	GST_N_2	51	114	3.2e-13	50.8
TkA01G515280	`PF00043`	GST_C	61	78	2.9e-07	31.4
TkA01G515280	`PF00043`	GST_C	155	230	2.9e-07	31.4
TkA01G515280	`PF14497`	GST_C_3	155	228	0.15	13.0
TkA01G515280	`PF13410`	GST_C_2	159	227	3.6e-11	43.7
TkA01G515280	`PF17171`	GST_C_6	170	227	0.032	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHH7`	Arabidopsis thaliana	sp\|Q9SHH7\|GSTUP_ARATH Glutathione S-transferase U25	64.100%	Swiss-Prot	High
`Q8L7C9`	Arabidopsis thaliana	sp\|Q8L7C9\|GSTUK_ARATH Glutathione S-transferase U20	65.800%	Swiss-Prot	High
`Q9ZRW8`	Arabidopsis thaliana	sp\|Q9ZRW8\|GSTUJ_ARATH Glutathione S-transferase U19	65.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card