TkA01G509480 | RubberDandelionOmics

Gene overview

TkA01G509480

Reference: TK1151 Chr: Chr01 Coordinates: 127649184-127654502 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4413 bp · TkA01G509480|TK1151|cDNA

AAGGCCCTAATTTATATACTGGGTATGGATGTTGTTGACCAGGGCGGTGTCAACATCCGAAGCCAATATAAATTCACTCGAGTCTGAGGATTCTCTGTTTTGCTAGGGTTTTCGCTCGTTTCTCCATTTTACTTTTACTTAAATTATCAGTGATTTCGGTGGAATTGCAGCTTGCATCAACATAAAGACAAATTGAAGGACATAGGAAGCTGGGTACCCTAATAAATTTTTGTTCTCGGAGAGCGAATTGCAAAAAAAAA...

CDS

Download CDS FASTA

2742 bp · TkA01G509480|TK1151|CDS

ATGACATCTTCAAATGCAACAAAAACTTCAATTGAGATAAACTTCAATGGTATGTTTGTGACTAGTCCATTTGCTTATGAAGGAGGTGAAATCAAAGCACTCGAAAATCTTGATTTCTCATGCATGGAATACCCTGAGTTTGAAGATTTCTTGAAGAAAGAAACAGATACAGACTGCTCAGGTATATATTATGTTATTCCTGGCAAGGAATTGCATAATGGATTAAAGCTTATAAAATCTGATGCGGATTTCAAACTTTT...

Protein

Download Protein FASTA

913 aa · TkA01G509480|TK1151|PROTEIN

MTSSNATKTSIEINFNGMFVTSPFAYEGGEIKALENLDFSCMEYPEFEDFLKKETDTDCSGIYYVIPGKELHNGLKLIKSDADFKLFVDYGHRSKGNKIAIYLEHFDEDLTEYLEEAVKHKVAESEDEIDTMSDDNGNNNDVDDDDDDEEEEEEEEEEDDDDDDIDDTASIDHLSADEIELIEVRKKKRARITEPNIESSSGQNGLYDAEVDDEKSKEDNMETEHERFLNELSMSLQRETNTIKKDEVKYPRHNPRTYWK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G509480`
TK1151 ID	TkA01G509480
OH-1004 ID	LXL04_001797
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 98.028 / OH-1004 84.820 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G509480`
Location	Chr01:127649184-127654502 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001797` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964

Rank 1 · TkA01G509480 · TK1151

Cytoplasm0.080

Rank 2 · TkA01G509480 · TK1151

Cell membrane0.023

Rank 3 · TkA01G509480 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA01G509480 · TK1151

Mitochondrion0.010

Rank 5 · TkA01G509480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26130PB1-like8-105 aa

PF02724CDC4595-212 aa

PF14566PTPlike_phytase105-133 aa

PF05642Sporozoite_P67108-165 aa

PF04147Nop14122-267 aa

PF14566PTPlike_phytase167-190 aa

PF03108DBD_Tnp_Mut266-332 aa

PF13917zf-CCHC_3268-278 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G509480	`PF26130`	PB1-like	8	105	5.6e-12	46.5
TkA01G509480	`PF02724`	CDC45	95	212	6.4	5.6
TkA01G509480	`PF14566`	PTPlike_phytase	105	133	0.45	11.3
TkA01G509480	`PF05642`	Sporozoite_P67	108	165	3.0	6.5
TkA01G509480	`PF04147`	Nop14	122	267	0.049	12.6
TkA01G509480	`PF14566`	PTPlike_phytase	167	190	0.45	11.3
TkA01G509480	`PF03108`	DBD_Tnp_Mut	266	332	1.6e-06	28.4
TkA01G509480	`PF13917`	zf-CCHC_3	268	278	0.085	13.4
TkA01G509480	`PF27640`	Meteorin_N	270	316	0.15	12.7
TkA01G509480	`PF10551`	MULE	471	560	1.1e-15	58.5
TkA01G509480	`PF00872`	Transposase_mut	485	563	0.027	14.1
TkA01G509480	`PF14566`	PTPlike_phytase	529	597	0.45	11.3
TkA01G509480	`PF10551`	MULE	621	668	1.1e-15	58.5
TkA01G509480	`PF04434`	SWIM	718	746	2.9e-09	37.0
TkA01G509480	`PF13917`	zf-CCHC_3	840	861	0.085	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card