TkA01G504930 | RubberDandelionOmics

Gene overview

TkA01G504930

Reference: TK1151 Chr: Chr01 Coordinates: 126440537-126444252 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2552 bp · TkA01G504930|TK1151|cDNA

AATAAATAACATACAATTAAAAATATTATATACATGGGAAATAACCTCGGCCACAAAACCTCAACTCAAACCAGCTACAGATGACGGAGTAGAAACTGAAACAACGCCATGCTTGTCCTACACAAAATGGCTTCATCCTCGCGTCCTATCTTCCTTTCATCTCTCCGATTACCACCAAAGCCTTTAATTTCATCTTCTTCTGTACTCTTCAATCCTATCACCAAGCAACTATATAACCAAAAGTCCCGATCGATTTGTCT...

CDS

Download CDS FASTA

2025 bp · TkA01G504930|TK1151|CDS

ATGCTTGTCCTACACAAAATGGCTTCATCCTCGCGTCCTATCTTCCTTTCATCTCTCCGATTACCACCAAAGCCTTTAATTTCATCTTCTTCTGTACTCTTCAATCCTATCACCAAGCAACTATATAACCAAAAGTCCCGATCGATTTGTCTTTTTAAGAAATCCCATTATCGCTTCTCATCGTCGCCGGTCGCCGTTGCCACCGATCCAGGTACTGCCGTCGCAGCAGAGGAAAGTAACGCTTCTGCTGACGCTCCTAA...

Protein

Download Protein FASTA

674 aa · TkA01G504930|TK1151|PROTEIN

MLVLHKMASSSRPIFLSSLRLPPKPLISSSSVLFNPITKQLYNQKSRSICLFKKSHYRFSSSPVAVATDPGTAVAAEESNASADAPKEVERVVLPSNESSETLLRIRHTCAHVMAMAVQKVFPDAKVTIGPWIEHGFYYDFDIEPLTDKDLKKIKKEMDRIIGRNLPLVREEVTRDEAHKRITSINEPYKLEILQSIKQEPITIYHIGNEWWDLCAGPHVETTGNINRRAVQLESVAGAYWRGDVNKPMLQRIYGTAWEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G504930`
TK1151 ID	TkA01G504930
OH-1004 ID	LXL04_001836
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G504930

Location Chr01:126440537-126444252 (-)

Description Similar to EMB2761: Threonine--tRNA ligase, chloroplastic/mitochondrial 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04842`	Threonine--tRNA ligase, chloroplastic/mitochondrial 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001836 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006435 threonyl-tRNA aminoacylation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0004829 threonine-tRNA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G04842

syd:Syncc9605_1034

sye:Syncc9902_0935

syg:sync_1866

syx:SynWH7803_0776

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.833

Rank 1 · TkA01G504930 · TK1151

Mitochondrion0.245

Rank 2 · TkA01G504930 · TK1151

Cytoplasm0.089

Rank 3 · TkA01G504930 · TK1151

Nucleus0.032

Rank 4 · TkA01G504930 · TK1151

Peroxisome0.030

Rank 5 · TkA01G504930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14767RPA_interact_M151-164 aa

PF07973tRNA_SAD202-254 aa

PF14767RPA_interact_M308-363 aa

PF00587tRNA-synt_2b361-566 aa

PF03129HGTP_anticodon474-494 aa

PF03129HGTP_anticodon578-666 aa

PF07973tRNA_SAD604-611 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G504930	`PF14767`	RPA_interact_M	151	164	0.11	13.8
TkA01G504930	`PF07973`	tRNA_SAD	202	254	4.8e-11	43.2
TkA01G504930	`PF14767`	RPA_interact_M	308	363	0.11	13.8
TkA01G504930	`PF00587`	tRNA-synt_2b	361	566	4.2e-50	171.0
TkA01G504930	`PF03129`	HGTP_anticodon	474	494	2.4e-17	63.6
TkA01G504930	`PF03129`	HGTP_anticodon	578	666	2.4e-17	63.6
TkA01G504930	`PF07973`	tRNA_SAD	604	611	4.8e-11	43.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IFC5`	Arabidopsis thaliana	sp\|F4IFC5\|SYTM2_ARATH Threonine--tRNA ligase, chloroplastic/mitochondrial 2	82.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card