RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G495250
Reference: TK1151 Chr: Chr01 Coordinates: 123928191-123928754 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

564 bp · TkA01G495250|TK1151|cDNA

ATGAACCACTCAACTTTCCATAACCAGAAACCCCATAAACACACCACCAAAAGACTCACCGAAGATCAAGTGAGATTACTCGAGTCATGTTTTGACGCGAGCAAAAAACTCGAGCCGGAGAAAAAACACGAGTTGTCCCGCCACCTTGGAATACCTCCACGACAAATAGCCATCTGGTACCAAAACAAAAGGGCACGTTGGAAGAACCAGAGTCTCGAACATGACTACACCATGCTACAACTCCAATTGGAGGCCACTTT...

CDS

Download CDS FASTA

564 bp · TkA01G495250|TK1151|CDS

ATGAACCACTCAACTTTCCATAACCAGAAACCCCATAAACACACCACCAAAAGACTCACCGAAGATCAAGTGAGATTACTCGAGTCATGTTTTGACGCGAGCAAAAAACTCGAGCCGGAGAAAAAACACGAGTTGTCCCGCCACCTTGGAATACCTCCACGACAAATAGCCATCTGGTACCAAAACAAAAGGGCACGTTGGAAGAACCAGAGTCTCGAACATGACTACACCATGCTACAACTCCAATTGGAGGCCACTTT...

Protein

Download Protein FASTA

187 aa · TkA01G495250|TK1151|PROTEIN

MNHSTFHNQKPHKHTTKRLTEDQVRLLESCFDASKKLEPEKKHELSRHLGIPPRQIAIWYQNKRARWKNQSLEHDYTMLQLQLEATLLETKHLQKEVEHLRGELNKVQVEQARHNRFYSNMNNQPLMESSFSRCGDDVGSSSRSLEDDTGNFYGFGEQVFEVSDMYNGTRGMMGTDIGLFGLKNNLL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G495250
TK1151 IDTkA01G495250
OH-1004 IDLXL04_001952
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G495250
LocationChr01:123928191-123928754 (+)
DescriptionSimilar to ATHB-52: Homeobox-leucine zipper protein ATHB-52
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g53980 Probable transcription factor. No verified direct reference in this release
At2g18550 Probable transcription factor. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os02g0649300 Probable transcription factor. No verified direct reference in this release
UniProt: A2X7U1 Probable transcription factor. No verified direct reference in this release
UniProt: A2XD08 Probable transcription factor. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001952 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0009637 response to blue light Biological Process
GO:0009646 response to absence of light Biological Process
GO:0009733 response to auxin Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0005634 nucleus Cellular Component
GO:0000976 transcription cis-regulatory region binding Molecular Function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function
GO:0003700 DNA-binding transcription factor activity Molecular Function
GO:0042802 identical protein binding Molecular Function
GO:0043565 sequence-specific DNA binding Molecular Function
KEGG gene cross-reference
ath:AT2G18550
ath:AT5G53980
dosa:Os02g0649300
dosa:Os08g0416000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.979
Rank 1 · TkA01G495250 · TK1151
Cytoplasm0.083
Rank 2 · TkA01G495250 · TK1151
Cell membrane0.016
Rank 3 · TkA01G495250 · TK1151
Endoplasmic reticulum0.010
Rank 4 · TkA01G495250 · TK1151
Plastid0.008
Rank 5 · TkA01G495250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046Homeodomain17-69 aa
PF01351RNase_HII25-120 aa
PF02183HALZ26-33 aa
PF06156YabA34-42 aa
PF05920Homeobox_KN39-66 aa
PF11932DUF345061-132 aa
PF15035Rootletin64-116 aa
PF03035RNA_capsid66-97 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G495250PF00046Homeodomain17697.6e-1658.4
TkA01G495250PF01351RNase_HII251200.1213.0
TkA01G495250PF02183HALZ26330.3811.7
TkA01G495250PF06156YabA34420.2612.6
TkA01G495250PF05920Homeobox_KN39660.01216.2
TkA01G495250PF11932DUF3450611320.09612.7
TkA01G495250PF15035Rootletin641160.08813.5
TkA01G495250PF03035RNA_capsid66970.07913.6
TkA01G495250PF06156YabA701350.2612.6
TkA01G495250PF02183HALZ721050.3811.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FN29Arabidopsis thalianasp|Q9FN29|ATB52_ARATH Homeobox-leucine zipper protein ATHB-5244.000%Swiss-ProtMedium
Q9ZU70Arabidopsis thalianasp|Q9ZU70|ATB21_ARATH Homeobox-leucine zipper protein ATHB-2141.200%Swiss-ProtMedium
Q6H6S3Oryza sativa subsp. japonicasp|Q6H6S3|HOX24_ORYSJ Homeobox-leucine zipper protein HOX2449.500%Swiss-ProtLow
A2X7U1Oryza sativa subsp. indicasp|A2X7U1|HOX24_ORYSI Homeobox-leucine zipper protein HOX2449.500%Swiss-ProtLow
A2XD08Oryza sativa subsp. indicasp|A2XD08|HOX21_ORYSI Homeobox-leucine zipper protein HOX2149.500%Swiss-ProtLow

JBrowse

View in Genome Browser