TkA01G489840 | RubberDandelionOmics

Gene overview

TkA01G489840

Reference: TK1151 Chr: Chr01 Coordinates: 122573564-122576059 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1244 bp · TkA01G489840|TK1151|cDNA

CCCAAACCCAGATGGTTGGGCCTCGAACGTAACGGAAGAGATTACTTCACAGTCCAACCACTTCCACCTGTTACAATCTCCTCTCGTCTTCTTCCTCCCTTCTTCTTTCCATTTCATCTTAAACAACACATCCCCACTTTGAATTCCATCACCACAACTGCAACTCCCAGTGGCTCGCCGGCTTTCATGGCTTCCTGTAGCTTTGGGGCTTCAAGTTTGAGAATTTACAACGGTCCTGCTATTGCCGAATCAACTAATTC...

CDS

Download CDS FASTA

1023 bp · TkA01G489840|TK1151|CDS

CCCAAACCCAGATGGTTGGGCCTCGAACGTAACGGAAGAGATTACTTCACAGTCCAACCACTTCCACCTGTTACAATCTCCTCTCGTCTTCTTCCTCCCTTCTTCTTTCCATTTCATCTTAAACAACACATCCCCACTTTGAATTCCATCACCACAACTGCAACTCCCAGTGGCTCGCCGGCTTTCATGGCTTCCTGTAGCTTTGGGGCTTCAAGTTTGAGAATTTACAACGGTCCTGCTATTGCCGAATCAACTAATTC...

Protein

Download Protein FASTA

340 aa · TkA01G489840|TK1151|PROTEIN

PKPRWLGLERNGRDYFTVQPLPPVTISSRLLPPFFFPFHLKQHIPTLNSITTTATPSGSPAFMASCSFGASSLRIYNGPAIAESTNSQKYSIGLRLSNSPKFDGLVLSQRSRKASNRCLCLPVKNAQSDTVTDLEDCSKVEKSSESTSQLTPNASHVEALLTQICDTTSIAEIEIKLGGFRLYVLRDLTGKSTPPPPPPPEYPVTAPVNGVTVESSEQNGSASSTSLAITKAEPSSGGIQTFLDTAADDGLVIIQSPRVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G489840`
TK1151 ID	TkA01G489840
OH-1004 ID	LXL04_002025
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 100.000 / OH-1004 95.775 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G489840`
Location	Chr01:122573564-122576059 (+)
Description	Similar to accB: Biotin carboxyl carrier protein of acetyl-CoA carboxylase (Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002025` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006633 fatty acid biosynthetic process Biological Process GO:0009317 acetyl-CoA carboxylase complex Cellular Component GO:0003989 acetyl-CoA carboxylase activity Molecular Function
KEGG gene cross-reference	ana:all5057 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.981

Rank 1 · TkA01G489840 · TK1151

Nucleus0.027

Rank 2 · TkA01G489840 · TK1151

Mitochondrion0.024

Rank 3 · TkA01G489840 · TK1151

Cytoplasm0.024

Rank 4 · TkA01G489840 · TK1151

Cell membrane0.013

Rank 5 · TkA01G489840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13375RnfC_N116-144 aa

PF25917BSH_RND175-222 aa

PF00364Biotin_lipoyl203-220 aa

PF13375RnfC_N203-220 aa

PF13375RnfC_N270-312 aa

PF00364Biotin_lipoyl276-329 aa

PF25917BSH_RND301-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G489840	`PF13375`	RnfC_N	116	144	0.089	13.5
TkA01G489840	`PF25917`	BSH_RND	175	222	0.067	13.8
TkA01G489840	`PF00364`	Biotin_lipoyl	203	220	3.2e-07	30.8
TkA01G489840	`PF13375`	RnfC_N	203	220	0.089	13.5
TkA01G489840	`PF13375`	RnfC_N	270	312	0.089	13.5
TkA01G489840	`PF00364`	Biotin_lipoyl	276	329	3.2e-07	30.8
TkA01G489840	`PF25917`	BSH_RND	301	331	0.067	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card