TkA01G487210 | RubberDandelionOmics

Gene overview

TkA01G487210

Reference: TK1151 Chr: Chr01 Coordinates: 121923146-121924382 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

714 bp · TkA01G487210|TK1151|cDNA

ATGGAGATTTCTAGCGGGACCTTTTTGAAACTTCAACAAGTGGTTAGAGGTGTGATACCCATGTCTTTGGTAGAAATGGCAAATTTGTTGAATAGCTTGAAGTTGATGGTGTGTCCTAGTGTGGACCGAAATATACATAACTTAGTTGTAAGCACAACTTACTATTCCGAGAGTACAAGTACAGAAGACATGTTGTGCCTTGTAAGAATTGTGAACCTGTTTTGCAGTGCTTTGGATGGTTCCTTGACCACAGTGTACTC...

CDS

Download CDS FASTA

714 bp · TkA01G487210|TK1151|CDS

ATGGAGATTTCTAGCGGGACCTTTTTGAAACTTCAACAAGTGGTTAGAGGTGTGATACCCATGTCTTTGGTAGAAATGGCAAATTTGTTGAATAGCTTGAAGTTGATGGTGTGTCCTAGTGTGGACCGAAATATACATAACTTAGTTGTAAGCACAACTTACTATTCCGAGAGTACAAGTACAGAAGACATGTTGTGCCTTGTAAGAATTGTGAACCTGTTTTGCAGTGCTTTGGATGGTTCCTTGACCACAGTGTACTC...

Protein

Download Protein FASTA

237 aa · TkA01G487210|TK1151|PROTEIN

MEISSGTFLKLQQVVRGVIPMSLVEMANLLNSLKLMVCPSVDRNIHNLVVSTTYYSESTSTEDMLCLVRIVNLFCSALDGSLTTVYSSVRVLTALHFPIHRPCFSQTTIPDVPEISTKSPLNQQIMCSLSYPDKRNIVARDDCYKVSILEMVKKDSYLPHETDGMKTVVDAFKSFVAWPKYLVKTDAKVQNVKLSKVVKTPADNEAAVKLVLKTVVKSVTKFTYVLPMLLKAQISAR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G487210`
TK1151 ID	TkA01G487210
OH-1004 ID	LXL04_033521
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	77.300
Protein coverage (%)	TK1151 27.848 / OH-1004 11.287 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G487210

Location Chr01:121923146-121924382 (-)

Description Similar to ALPHAC-AD: AP-2 complex subunit alpha-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22780`	Subunit of the adaptor protein complex 2 (AP-2).	Identification and functional characterization of Arabidopsis AP180, a binding partner of plant alphaC-adaptin.2004 · DOI: 10.1242/jcs.01062
`At5g22770`	Subunit of the adaptor protein complex 2 (AP-2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033521 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0010038 response to metal ion Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0051924 regulation of calcium ion transport Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:0080147 root hair cell development Biological Process

GO:0097275 intracellular ammonium homeostasis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G22770

ath:AT5G22780

ath:AT5G39000

ath:AT5G59700

ath:AT5G61350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.383

Rank 1 · TkA01G487210 · TK1151

Nucleus0.340

Rank 2 · TkA01G487210 · TK1151

Mitochondrion0.236

Rank 3 · TkA01G487210 · TK1151

Cell membrane0.079

Rank 4 · TkA01G487210 · TK1151

Endoplasmic reticulum0.063

Rank 5 · TkA01G487210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02296Alpha_adaptin_C20-70 aa

PF26133DUF8039140-184 aa

PF02296Alpha_adaptin_C182-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G487210	`PF02296`	Alpha_adaptin_C	20	70	0.14	13.1
TkA01G487210	`PF26133`	DUF8039	140	184	3.7e-06	28.0
TkA01G487210	`PF02296`	Alpha_adaptin_C	182	198	0.14	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPK4`	Arabidopsis thaliana	sp\|Q8LPK4\|AP2A2_ARATH AP-2 complex subunit alpha-2	60.600%	Swiss-Prot	Low
`Q8LPL6`	Arabidopsis thaliana	sp\|Q8LPL6\|AP2A1_ARATH AP-2 complex subunit alpha-1	60.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card