TkA01G485210 | RubberDandelionOmics

Gene overview

TkA01G485210

Reference: TK1151 Chr: Chr01 Coordinates: 121452073-121453582 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1398 bp · TkA01G485210|TK1151|cDNA

TGACTGGTTTGTTGCCTCTGTTAGATTCAGGAAAATCATTTCTATATATGTCACATCCAAACACCAGTACACCACAATAAAACTTGGATATTTTGTAAAATAAAAGAAAAGAACAAGTGTCTATAAACAAGCACGTGAAATATTTAACGATCGATCGATCGACGAATCAAGAAATGAAAGCAGCATTGCTACCTCAGTCTTGACGCGTTTCTGGATCGCTCAATCCCAAAAGAATCGCTGCCTTCCGAATTTCAATCCTG...

CDS

Download CDS FASTA

786 bp · TkA01G485210|TK1151|CDS

ATGTCGGTGGAATCTGCCATTACCAACAACGTTAATGGTGGCTCCGTGTTCAGCAATGGCGAAGAGAAGAAACCGTTTAGGATCTTCGTAGGCTACGACACACGTGAAGATGTGGCTTACGAGGTGTGTCGGTACTCGATCCTGAAACGATCTTCGATCCCCGTTGAAGTTATCCCCATCAAACAATCTGAATTACGAGAGAAGAAATATTTTTGGCGCGAACGTAATATACTCGAAAGCACTGAATTCTCATTCACTCG...

Protein

Download Protein FASTA

261 aa · TkA01G485210|TK1151|PROTEIN

MSVESAITNNVNGGSVFSNGEEKKPFRIFVGYDTREDVAYEVCRYSILKRSSIPVEVIPIKQSELREKKYFWRERNILESTEFSFTRFLTPFLANYEGWAVFVDCDFLYLGDVKELHDLIDEKYAMMCVQHDYTPKETTKMDGAVQTAYPRKNWSSMVLYNCGHPKNKILTPETVNLESGAFLHRFQWLEDHEIGSVPFIWNFLVGHNHVVMGDPSTYPKAIHYTSGGPWFEAWKDCEFGDLWLKELEEYEKVKEKEKKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G485210`
TK1151 ID	TkA01G485210
OH-1004 ID	LXL04_002061
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G485210

Location Chr01:121452073-121453582 (-)

Description Similar to CDI: Protein CDI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64980`	Probable nucleotide-diphospho-sugar transferase required for pollen germination and tube growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002061 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016740 transferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G64980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.650

Rank 1 · TkA01G485210 · TK1151

Nucleus0.430

Rank 2 · TkA01G485210 · TK1151

Cell membrane0.070

Rank 3 · TkA01G485210 · TK1151

Golgi apparatus0.064

Rank 4 · TkA01G485210 · TK1151

Endoplasmic reticulum0.056

Rank 5 · TkA01G485210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11352DUF315533-93 aa

PF01501Glyco_transf_856-137 aa

PF31159Rhodo_GlycoT99-134 aa

PF01501Glyco_transf_8200-231 aa

PF31159Rhodo_GlycoT211-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G485210	`PF11352`	DUF3155	33	93	0.23	12.6
TkA01G485210	`PF01501`	Glyco_transf_8	56	137	0.064	13.5
TkA01G485210	`PF31159`	Rhodo_GlycoT	99	134	0.12	12.7
TkA01G485210	`PF01501`	Glyco_transf_8	200	231	0.064	13.5
TkA01G485210	`PF31159`	Rhodo_GlycoT	211	251	0.12	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIP8`	Arabidopsis thaliana	sp\|Q9XIP8\|CDI_ARATH Protein CDI	77.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card