TkA01G470750 | RubberDandelionOmics

Gene overview

TkA01G470750

Reference: TK1151 Chr: Chr01 Coordinates: 117848242-117849524 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

610 bp · TkA01G470750|TK1151|cDNA

ATGGTTCTCACAGATTTGCTCTTGAGGTACATAAATCTTCTACCCGAGACAGTTGCAAGAACGTTGGTCCCACGGATGAGGGTTGTTAAAGGGAGTGGAAAAGCAATTAATTACTTAACGCCTCCAAGAATTTTACTTGCTTTGGTCACTGCGTGGGTAAGACGAGGACGTTGGTTCGATGACAAGGGAAGAGCGTTATATGCAGCAGAAGCAGATAGACTAAGAAATTGGGCTGAAAGTCGAACTCGTTTTTCGTTCAC...

CDS

Download CDS FASTA

396 bp · TkA01G470750|TK1151|CDS

ATGGTTCTCACAGATTTGCTCTTGAGGTACATAAATCTTCTACCCGAGACAGTTGCAAGAACGTTGGTCCCACGGATGAGGGTTGTTAAAGGGAGTGGAAAAGCAATTAATTACTTAACGCCTCCAAGAATTTTACTTGCTTTGGTCACTGCGTGGGTAAGACGAGGACGTTGGTTCGATGACAAGGGAAGAGCGTTATATGCAGCAGAAGCAGATAGACTAAGAAATTGGGCTGAAAGTCGAACTCGTTTTTCGTTCAC...

Protein

Download Protein FASTA

131 aa · TkA01G470750|TK1151|PROTEIN

MVLTDLLLRYINLLPETVARTLVPRMRVVKGSGKAINYLTPPRILLALVTAWVRRGRWFDDKGRALYAAEADRLRNWAESRTRFSFTDAMEMYTENTWVSVFSLSIVCAFIILSSTTGNASPGHVDHFHLL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G470750`
TK1151 ID	TkA01G470750
OH-1004 ID	LXL04_002546
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.400
Protein coverage (%)	TK1151 100.000 / OH-1004 24.525 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G470750

Location Chr01:117848242-117849524 (+)

Description Similar to NYC1: Probable chlorophyll(ide) b reductase NYC1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13250`	Involved in chlorophyll b degradation.	Participation of chlorophyll b reductase in the initial step of the degradation of light-harvesting chlorophyll a/b-protein complexes in Arabidopsis.2009 · DOI: 10.1074/jbc.m109.008912

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0227100`	Required for proper chloroplast degradation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002546 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010304 PSII associated light-harvesting complex II catabolic process Biological Process

GO:0015996 chlorophyll catabolic process Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0034256 chlorophyll(ide) b reductase activity Molecular Function

KEGG gene cross-reference

ath:AT4G13250

ath:AT5G04900

dosa:Os01g0227100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.276

Rank 1 · TkA01G470750 · TK1151

Mitochondrion0.240

Rank 2 · TkA01G470750 · TK1151

Endoplasmic reticulum0.158

Rank 3 · TkA01G470750 · TK1151

Nucleus0.120

Rank 4 · TkA01G470750 · TK1151

Cytoplasm0.117

Rank 5 · TkA01G470750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93ZA0`	Arabidopsis thaliana	sp\|Q93ZA0\|NYC1_ARATH Probable chlorophyll(ide) b reductase NYC1, chloroplastic	77.600%	Swiss-Prot	High
`Q5N800`	Oryza sativa subsp. japonica	sp\|Q5N800\|NYC1_ORYSJ Probable chlorophyll(ide) b reductase NYC1, chloroplastic	81.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card