TkA01G448650 | RubberDandelionOmics

Gene overview

TkA01G448650

Reference: TK1151 Chr: Chr01 Coordinates: 112346106-112348045 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1072 bp · TkA01G448650|TK1151|cDNA

AATCAACCGAGCTGAATAGAACAATCACAAACTTCACAAATGAGTTGCTCCTCCGCCATGGCTATCCTTATTCCTTCAACTCCGGCTCTTCTTCCTCACAAGAAGGTGAGCTATGTTTTGGTTGCAAGTATACCACTAAGGAAAATCAATCACTCAAATGTCCTTCAATATGGTAACATTTGCAGACATCGTGTGCTAACAAAAGCTCAAACGTCTCTTGAAGCAGACACCAGTGAAAAAGATTCAGTTACTTCTGAATC...

CDS

Download CDS FASTA

615 bp · TkA01G448650|TK1151|CDS

ATGAGTTGCTCCTCCGCCATGGCTATCCTTATTCCTTCAACTCCGGCTCTTCTTCCTCACAAGAAGGTGAGCTATGTTTTGGTTGCAAGTATACCACTAAGGAAAATCAATCACTCAAATGTCCTTCAATATGGTAACATTTGCAGACATCGTGTGCTAACAAAAGCTCAAACGTCTCTTGAAGCAGACACCAGTGAAAAAGATTCAGTTACTTCTGAATCCGTTGATGACGAGAATGATTTTGGAGTTGTAAGTGTTCA...

Protein

Download Protein FASTA

204 aa · TkA01G448650|TK1151|PROTEIN

MSCSSAMAILIPSTPALLPHKKVSYVLVASIPLRKINHSNVLQYGNICRHRVLTKAQTSLEADTSEKDSVTSESVDDENDFGVVSVHHVGILCENLERSLDFYQNILGLKINEARPHDKLPYRGAWLWVGSEMIHLMELPNPDPYTGRPEHGGRDRHTCIAIRDVLKLKAILDKAGIPYTLSRSGRPAIFTRDPDTNALEFTQI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G448650`
TK1151 ID	TkA01G448650
OH-1004 ID	LXL04_002388
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G448650`
Location	Chr01:112346106-112348045 (-)
Description	Similar to ywkD: Uncharacterized protein YwkD (Bacillus subtilis (strain 168)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002388` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006952 defense response Biological Process GO:0006970 response to osmotic stress Biological Process GO:0006979 response to oxidative stress Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0009414 response to water deprivation Biological Process GO:0009611 response to wounding Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process GO:0010045 response to nickel cation Biological Process GO:0010224 response to UV-B Biological Process GO:0051595 response to methylglyoxal Biological Process
KEGG gene cross-reference	ath:AT1G15380 bsu:BSU37020 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.986

Rank 1 · TkA01G448650 · TK1151

Mitochondrion0.023

Rank 2 · TkA01G448650 · TK1151

Cytoplasm0.019

Rank 3 · TkA01G448650 · TK1151

Nucleus0.016

Rank 4 · TkA01G448650 · TK1151

Peroxisome0.014

Rank 5 · TkA01G448650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02208Sorb31-36 aa

PF02208Sorb80-104 aa

PF00903Glyoxalase86-201 aa

PF13669Glyoxalase_487-181 aa

PF13468Glyoxalase_387-183 aa

PF22677Ble-like_N88-113 aa

PF12681Glyoxalase_291-113 aa

PF13986DUF4224169-189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G448650	`PF02208`	Sorb	31	36	0.28	11.5
TkA01G448650	`PF02208`	Sorb	80	104	0.28	11.5
TkA01G448650	`PF00903`	Glyoxalase	86	201	4.6e-13	50.3
TkA01G448650	`PF13669`	Glyoxalase_4	87	181	3.3e-06	28.1
TkA01G448650	`PF13468`	Glyoxalase_3	87	183	0.28	11.9
TkA01G448650	`PF22677`	Ble-like_N	88	113	0.00082	19.8
TkA01G448650	`PF12681`	Glyoxalase_2	91	113	0.25	12.0
TkA01G448650	`PF13986`	DUF4224	169	189	0.02	15.6
TkA01G448650	`PF02208`	Sorb	172	181	0.28	11.5
TkA01G448650	`PF12681`	Glyoxalase_2	190	201	0.25	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card