TkA01G436750 | RubberDandelionOmics

Gene overview

TkA01G436750

Reference: TK1151 Chr: Chr01 Coordinates: 109142433-109145242 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1308 bp · TkA01G436750|TK1151|cDNA

ATGGCCCGTACTAGAAGTGGGCAGGGAGGTGGACAAAGCGGAAGTCAAAACTCTCGGGGAAGACCGAGAAGTGTGAACCGCCCTCCTCCAATTTTAGAGGATGGAAATAGCAATCCCGCTCCGGTAACCTTAGAAGCTATCCAAAAGCTTCTCCATGATCAACAAGTGCAAAACCGAGCCGAGATGAATAACCTTATAAACGAAAGGTTACAAGAGTTTTCAAAAGCTCTAACTCATGATGTGGCATCCGAAAGTGTGCA...

CDS

Download CDS FASTA

1308 bp · TkA01G436750|TK1151|CDS

ATGGCCCGTACTAGAAGTGGGCAGGGAGGTGGACAAAGCGGAAGTCAAAACTCTCGGGGAAGACCGAGAAGTGTGAACCGCCCTCCTCCAATTTTAGAGGATGGAAATAGCAATCCCGCTCCGGTAACCTTAGAAGCTATCCAAAAGCTTCTCCATGATCAACAAGTGCAAAACCGAGCCGAGATGAATAACCTTATAAACGAAAGGTTACAAGAGTTTTCAAAAGCTCTAACTCATGATGTGGCATCCGAAAGTGTGCA...

Protein

Download Protein FASTA

435 aa · TkA01G436750|TK1151|PROTEIN

MARTRSGQGGGQSGSQNSRGRPRSVNRPPPILEDGNSNPAPVTLEAIQKLLHDQQVQNRAEMNNLINERLQEFSKALTHDVASESVHPSNSPTHESHHNSRNSPSPPLQNPPGPRCTFKDFMVCRPKEFQGGKDPKVTMHWLAEIEQVLRVCRCEEYMKVTFASQMLKGDALTWWNTLTTSLGGGVVASFTWAEFVRRIKLKFCSPRHKEMIVNEFFALKKGNMTVDEYSKKFTDMIPFLEDTLPLESGRINRYVNGLPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G436750`
TK1151 ID	TkA01G436750
OH-1004 ID	LXL04_007131
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	78.500
Protein coverage (%)	TK1151 89.885 / OH-1004 24.725 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G436750`
Location	Chr01:109142433-109145242 (-)
Description	Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007131` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function
KEGG gene cross-reference	sce:YGR109W-B sce:YIL082W-A spo:2538755 spo:2541833 spo:2541991 spo:3361422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.733

Rank 1 · TkA01G436750 · TK1151

Cytoplasm0.318

Rank 2 · TkA01G436750 · TK1151

Mitochondrion0.050

Rank 3 · TkA01G436750 · TK1151

Cell membrane0.036

Rank 4 · TkA01G436750 · TK1151

Extracellular0.025

Rank 5 · TkA01G436750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19259Ty3_capsid117-290 aa

PF03732PEG10_N-capsid125-203 aa

PF19148DUF5830274-332 aa

PF12353eIF3g301-353 aa

PF21352Zn_ribbon_Thio2321-330 aa

PF00098zf-CCHC325-331 aa

PF00098zf-CCHC340-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G436750	`PF19259`	Ty3_capsid	117	290	3.1e-13	50.3
TkA01G436750	`PF03732`	PEG10_N-capsid	125	203	1.2e-13	51.9
TkA01G436750	`PF19148`	DUF5830	274	332	0.21	12.3
TkA01G436750	`PF12353`	eIF3g	301	353	0.14	13.1
TkA01G436750	`PF21352`	Zn_ribbon_Thio2	321	330	0.32	11.6
TkA01G436750	`PF00098`	zf-CCHC	325	331	0.52	11.2
TkA01G436750	`PF00098`	zf-CCHC	340	350	0.52	11.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card