TkA01G434380 | RubberDandelionOmics

Gene overview

TkA01G434380

Reference: TK1151 Chr: Chr01 Coordinates: 108504293-108504952 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · TkA01G434380|TK1151|cDNA

ATGGCTGGACAAACAACCGGAAAAGTCAGTCATATACGTGTCTTTTGGAAGCGGCGGAACAATATCAGCCGAGCAAATTATAGAGAGTTGGCTTGTGGATTGGAGATGAGCCAACAGAGATTTGTTTGGGTGGTCCGGCCACCTACCGGTCATTCCGGTGTACTAAATGGTCAAGCAGATTATCTCCCCGACGGGTTCCTGACCCGAACCAAGAAATTGGGTTTTGTTGTGCCTTCATGGGCCCCACAGGTGGAGATTTT...

CDS

Download CDS FASTA

627 bp · TkA01G434380|TK1151|CDS

ATGGCTGGACAAACAACCGGAAAAGTCAGTCATATACGTGTCTTTTGGAAGCGGCGGAACAATATCAGCCGAGCAAATTATAGAGAGTTGGCTTGTGGATTGGAGATGAGCCAACAGAGATTTGTTTGGGTGGTCCGGCCACCTACCGGTCATTCCGGTGTACTAAATGGTCAAGCAGATTATCTCCCCGACGGGTTCCTGACCCGAACCAAGAAATTGGGTTTTGTTGTGCCTTCATGGGCCCCACAGGTGGAGATTTT...

Protein

Download Protein FASTA

208 aa · TkA01G434380|TK1151|PROTEIN

MAGQTTGKVSHIRVFWKRRNNISRANYRELACGLEMSQQRFVWVVRPPTGHSGVLNGQADYLPDGFLTRTKKLGFVVPSWAPQVEILNHASVGGFLTHCGWNSILESISSGVPMIAWALYAEQRMNAAMLTEELKVAVRPEVLPAKKEVGREEVEKMVRCLMEGEEGRTMREKVERLKEGAKEAINVNGSSYISTCRFIEEYCLSRIS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G434380`
TK1151 ID	TkA01G434380
OH-1004 ID	LXL04_002637
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	82.300
Protein coverage (%)	TK1151 89.904 / OH-1004 41.253 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G434380

Location Chr01:108504293-108504952 (+)

Description Similar to GT5: Anthocyanidin 3-O-glucosyltransferase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50740`	UDP-glycosyltransferase that glucosylates coniferyl aldehyde to form coniferyl aldehyde 4-O-glucoside.	Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde.2005 · DOI: 10.1016/j.febslet.2005.04.016
`At5g66690`	Involved in the O-glucosylation of monolignols (alcohol monomers of lignin).	Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates.2003 · DOI: 10.1007/s00425-002-0969-0 Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde.2005 · DOI: 10.1016/j.febslet.2005.04.016 The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana.2006 · DOI: 10.1111/j.1365-313x.2006.02872.x Enzymatic and metabolic engineering for efficient production of syringin, sinapyl alcohol 4-O-glucoside, in Arabidopsis thaliana.2014 · DOI: 10.1016/j.phytochem.2014.03.003
`At2g18570`	UDP-glycosyltransferase 72D1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002637 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009636 response to toxic substance Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009808 lignin metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0047209 coniferyl-alcohol glucosyltransferase activity Molecular Function

GO:0047213 anthocyanidin 3-O-glucosyltransferase activity Molecular Function

GO:0047218 hydroxycinnamate 4-beta-glucosyltransferase activity Molecular Function

GO:0050505 hydroquinone glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:CAC35167

ath:AT2G18570

ath:AT3G50740

ath:AT5G66690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.497

Rank 1 · TkA01G434380 · TK1151

Cytoplasm0.279

Rank 2 · TkA01G434380 · TK1151

Mitochondrion0.096

Rank 3 · TkA01G434380 · TK1151

Nucleus0.085

Rank 4 · TkA01G434380 · TK1151

Plastid0.065

Rank 5 · TkA01G434380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00201UDPGT22-132 aa

PF04101Glyco_tran_28_C96-166 aa

PF28110DpdG103-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G434380	`PF00201`	UDPGT	22	132	1.6e-19	70.9
TkA01G434380	`PF04101`	Glyco_tran_28_C	96	166	0.22	12.3
TkA01G434380	`PF28110`	DpdG	103	159	0.28	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A84`	Arabidopsis thaliana	sp\|Q94A84\|U72E1_ARATH UDP-glycosyltransferase 72E1	53.900%	Swiss-Prot	High
`Q9LVR1`	Arabidopsis thaliana	sp\|Q9LVR1\|U72E2_ARATH UDP-glycosyltransferase 72E2	49.700%	Swiss-Prot	Medium
`Q9ZU72`	Arabidopsis thaliana	sp\|Q9ZU72\|U72D1_ARATH UDP-glycosyltransferase 72D1	54.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card