TkA01G430570 | RubberDandelionOmics

Gene overview

TkA01G430570

Reference: TK1151 Chr: Chr01 Coordinates: 107566706-107584520 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6107 bp · TkA01G430570|TK1151|cDNA

CCGAGCGCTGCCGCACTGGTGTGGAACCCAATACCCTCTAAACCCTCGGCCTCAATCAAACTAGGGCAATTCCCGCCTTTCTACCCTCTTGAAGTTTCCTCCACGACTGAGCCGGAATCGGCGATGGTGTCAGCTAAGCAACTCCTCTCTACCATTGAGTCCACGCTCTTGGGCACCACTCCCCCATCAGCTTCGCAGAGGATTGAGCTCATCCACGCTCTTCGTTCTTCTCTCCCTTCTCTTCAGTCTCTTTTGTCATT...

CDS

Download CDS FASTA

5736 bp · TkA01G430570|TK1151|CDS

CCGAGCGCTGCCGCACTGGTGTGGAACCCAATACCCTCTAAACCCTCGGCCTCAATCAAACTAGGGCAATTCCCGCCTTTCTACCCTCTTGAAGTTTCCTCCACGACTGAGCCGGAATCGGCGATGGTGTCAGCTAAGCAACTCCTCTCTACCATTGAGTCCACGCTCTTGGGCACCACTCCCCCATCAGCTTCGCAGAGGATTGAGCTCATCCACGCTCTTCGTTCTTCTCTCCCTTCTCTTCAGTCTCTTTTGTCATT...

Protein

Download Protein FASTA

1911 aa · TkA01G430570|TK1151|PROTEIN

PSAAALVWNPIPSKPSASIKLGQFPPFYPLEVSSTTEPESAMVSAKQLLSTIESTLLGTTPPSASQRIELIHALRSSLPSLQSLLSFPPPKPSDRAQVQSKEVRLPDSGPIPLDDQDVQIALKLSDDLHLNEIDCVQLLVSANQEWGLLGRGPLDILRLAEGLWYTERRDLITALYTLLRAIVLDQGLEPDLQADILKYVEDLISGGLRQRLITLIKELNREEPAGVGGPNSERYILDSRGALVERRAVVCRERLILGHC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G430570`
TK1151 ID	TkA01G430570
OH-1004 ID	LXL04_002678
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 99.738 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G430570

Location Chr01:107566706-107584520 (-)

Description Similar to NUP205: Nuclear pore complex protein NUP205

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51200`	Nuclear pore complex protein NUP205.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002678 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0006999 nuclear pore organization Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009682 induced systemic resistance Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0015031 protein transport Biological Process

GO:0032922 circadian regulation of gene expression Biological Process

GO:0042332 gravitaxis Biological Process

GO:0051028 mRNA transport Biological Process

GO:0051292 nuclear pore complex assembly Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

dme:Dmel_CG11943

hsa:23165

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.745

Rank 1 · TkA01G430570 · TK1151

Cytoplasm0.321

Rank 2 · TkA01G430570 · TK1151

Golgi apparatus0.031

Rank 3 · TkA01G430570 · TK1151

Lysosome / Vacuole0.028

Rank 4 · TkA01G430570 · TK1151

Cell membrane0.027

Rank 5 · TkA01G430570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11894Nup19268-1649 aa

PF21093Nup188_N-subdom_III690-858 aa

PF21293RNAseD_HRDC_C1235-1266 aa

PF21093Nup188_N-subdom_III1659-1695 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G430570	`PF11894`	Nup192	68	1649	9.6e-106	355.4
TkA01G430570	`PF21093`	Nup188_N-subdom_III	690	858	5.2e-06	26.4
TkA01G430570	`PF21293`	RNAseD_HRDC_C	1235	1266	0.4	11.3
TkA01G430570	`PF21093`	Nup188_N-subdom_III	1659	1695	5.2e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KBW6`	Arabidopsis thaliana	sp\|F4KBW6\|NU205_ARATH Nuclear pore complex protein NUP205	61.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card