TkA01G419280 | RubberDandelionOmics

Gene overview

TkA01G419280

Reference: TK1151 Chr: Chr01 Coordinates: 104710928-104716571 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3890 bp · TkA01G419280|TK1151|cDNA

CAATGGTTCGTCCTGTCGAACAACAGTGCTGTACACGTTGTCGTCTGACGTGTAACTGTAAGTCGCCTCCCTCGTAAGCTGATTTCAGACGTAACTTTCAGCTTTCCTTCTCTTTCAATCGATCAACCGCCATAGATTCACCACCGACAAAGCTTGTCAATTGTTTACCAGCTCCAAACTAACTGCTACAACTCGATTACCCCAACTAGATTCACCACCGATAAAGCTTGTCAATTTTAGGGTTTCAGGACACTGGTTAC...

CDS

Download CDS FASTA

1698 bp · TkA01G419280|TK1151|CDS

ATGAAGGACAAGAGGGACACTATACGTCAACATTCTCCACCACCACCACCGCCTCCTCCTCCTCCGTTAAAGGACAAGTCAGTTATGAGAACTGGACCCTCTCCACCACCACCTCCACCACCTGTAGAGGAGTGTGGAGATGAAAGACTTGCATCCCCAATTCCCCCGCCACCACCACCACCACCTCCTCCTCCAGCATCACGTGTTTCTTCAGGTCCACCACCACCACCACCGCCTCCTCCAGCATCACGGGCTTCTTC...

Protein

Download Protein FASTA

565 aa · TkA01G419280|TK1151|PROTEIN

MKDKRDTIRQHSPPPPPPPPPPLKDKSVMRTGPSPPPPPPPVEECGDERLASPIPPPPPPPPPPPASRVSSGPPPPPPPPPASRASSGPPPPPTPAPNISSGRPPPPPPTFSNGSMKKGVVPPPPPPKAGNNPGAPPPLVKGRSLSKAGSLKFQQSRKLKPLHWLKITRAVQGSLWAETQKSGDLAKAPEIDISELESLFSASNPKPEQGAEKSRSRAALANKPEKIQLIEHRRAYNCEIMLSKVKIPLNELMDHVLALD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G419280`
TK1151 ID	TkA01G419280
OH-1004 ID	LXL04_028211
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.700
Protein coverage (%)	TK1151 69.735 / OH-1004 31.440 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G419280

Location Chr01:104710928-104716571 (+)

Description Similar to FH13: Formin-like protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58160`	Formin-like protein 13.	No verified direct reference in this release
`At2g25050`	Formin-like protein 18.	No verified direct reference in this release
`At3g32400`	Formin-like protein 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0280200`	Formin-like protein 6.	No verified direct reference in this release
`Os02g0794900`	Formin-like protein 7.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028211 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0003779 actin binding Molecular Function

GO:0004721 phosphoprotein phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT3G32400

ath:AT5G58160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.654

Rank 1 · TkA01G419280 · TK1151

Cell membrane0.283

Rank 2 · TkA01G419280 · TK1151

Nucleus0.204

Rank 3 · TkA01G419280 · TK1151

Golgi apparatus0.063

Rank 4 · TkA01G419280 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA01G419280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02181FH2153-524 aa

PF30343Don_juan434-467 aa

PF02181FH2533-557 aa

PF30343Don_juan536-555 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G419280	`PF02181`	FH2	153	524	6.1e-114	381.7
TkA01G419280	`PF30343`	Don_juan	434	467	0.08	14.2
TkA01G419280	`PF02181`	FH2	533	557	6.1e-114	381.7
TkA01G419280	`PF30343`	Don_juan	536	555	0.08	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVN1`	Arabidopsis thaliana	sp\|Q9LVN1\|FH13_ARATH Formin-like protein 13	71.200%	Swiss-Prot	High
`Q9SK28`	Arabidopsis thaliana	sp\|Q9SK28\|FH18_ARATH Formin-like protein 18	69.000%	Swiss-Prot	High
`Q9LH02`	Arabidopsis thaliana	sp\|Q9LH02\|FH17_ARATH Formin-like protein 17	67.800%	Swiss-Prot	High
`Q6ZCX3`	Oryza sativa subsp. japonica	sp\|Q6ZCX3\|FH6_ORYSJ Formin-like protein 6	69.300%	Swiss-Prot	Medium
`Q6K8Z4`	Oryza sativa subsp. japonica	sp\|Q6K8Z4\|FH7_ORYSJ Formin-like protein 7	67.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card