RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G414790
Reference: TK1151 Chr: Chr01 Coordinates: 103494615-103497579 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1882 bp · TkA01G414790|TK1151|cDNA

GTAGAAACGAAAAGAGTAGAAAACGCATCCGGTCGTTGGCAAATTGAGACACGTCGATTCCGCATATAAAAGGCAATTCGCTAAAACCCTCCAAATCTACGCGCACCCGGCCAGATCTTTATGGATCAACCGATCCATCCTTGGGCATCAACAACTGTTTTAGGGCTTCTTTCGACCTTTAATTCCATCAAACACTTGTTTCTTCCCCCCTGCATCTCTGCCTAACTCGTTGATTCTACATTCCCCGACACAGCCGTTTC...

CDS

Download CDS FASTA

1035 bp · TkA01G414790|TK1151|CDS

ATGAGGAAGAAGAGAAAAGGCAGTGACCTAAATAAAAAGAAAATGGTGGAATCAACAGAGTCTCTGATATCAAATCTCAAGTGTCATTACTCTCTAGAAGATTACGTTAGATTGAAAAAAAGCTGCTGTAAGGAAGATGTGATCTGCGGTGGTGGTGATTTCAGGCTTGCTGCAACTGCTCCCCCTTGTGCAACCTCGTCACTGGTTTTATCAGGGAGAGGGATTAAGAGGAAAATTGGGTGTATCGATGTAGCCACTCA...

Protein

Download Protein FASTA

344 aa · TkA01G414790|TK1151|PROTEIN

MRKKRKGSDLNKKKMVESTESLISNLKCHYSLEDYVRLKKSCCKEDVICGGGDFRLAATAPPCATSSLVLSGRGIKRKIGCIDVATQNKIAEDYVKGATIGKGKFGSVWLCRCRVSGVEFACKTLVKGEETVHREVEIMQHLSGHPGVVTLKAVYEDSESFHLVMELCSGGRLIDQMTKEEGRYSEQRAANIFKELMMVIKFCHDMGVVHRDVKPENILLTASGKIKLADFGLAVRITNGQRLGGLAGSPAYVAPEVLTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G414790
TK1151 IDTkA01G414790
OH-1004 IDLXL04_031130
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)83.400
Protein coverage (%)TK1151 98.837 / OH-1004 78.105
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G414790
LocationChr01:103494615-103497579 (-)
DescriptionSimilar to PEPKR2: Serine/threonine-protein kinase PEPKR2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g12680 Serine/threonine-protein kinase PEPKR2. No verified direct reference in this release
At4g23650 May play a role in signal transduction pathways that involve calcium as a second messenger.
CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca(2+)-permeable channels and stomatal closure.2006 · DOI: 10.1371/journal.pbio.0040327
At4g04695 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At3g04530 Calcium-independent kinase involved in light-dependent phosphoenolpyruvate carboxylase phosphorylation. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os05g0491900 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031130 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0035556 intracellular signal transduction Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function
GO:0005509 calcium ion binding Molecular Function
GO:0005516 calmodulin binding Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0009931 calcium-dependent protein serine/threonine kinase activity Molecular Function
GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference
ath:AT1G12680
ath:AT1G50700
ath:AT1G76040
dosa:Os03g0788500
gmx:547825
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.521
Rank 1 · TkA01G414790 · TK1151
Nucleus0.493
Rank 2 · TkA01G414790 · TK1151
Cell membrane0.072
Rank 3 · TkA01G414790 · TK1151
Mitochondrion0.070
Rank 4 · TkA01G414790 · TK1151
Endoplasmic reticulum0.052
Rank 5 · TkA01G414790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14531Kinase-like93-141 aa
PF00069Pkinase94-289 aa
PF07714PK_Tyr_Ser-Thr98-294 aa
PF06293Kdo129-241 aa
PF01636APH129-175 aa
PF01163RIO1131-239 aa
PF03109ABC1154-242 aa
PF12330Haspin_kinase157-234 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G414790PF14531Kinase-like931410.001518.6
TkA01G414790PF00069Pkinase942898.8e-55186.6
TkA01G414790PF07714PK_Tyr_Ser-Thr982942.8e-30106.2
TkA01G414790PF06293Kdo1292415.1e-0523.5
TkA01G414790PF01636APH1291750.001119.5
TkA01G414790PF01163RIO11312390.0001622.1
TkA01G414790PF03109ABC11542421.3e-0731.8
TkA01G414790PF12330Haspin_kinase1572340.07612.8
TkA01G414790PF14531Kinase-like1962590.001518.6
TkA01G414790PF17667Pkinase_fungal2042590.1311.7
TkA01G414790PF01636APH2052340.001119.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8W490Arabidopsis thalianasp|Q8W490|PEPK2_ARATH Serine/threonine-protein kinase PEPKR262.300%Swiss-ProtHigh
Q42479Arabidopsis thalianasp|Q42479|CDPK3_ARATH Calcium-dependent protein kinase 338.100%Swiss-ProtMedium
Q9S9V0Arabidopsis thalianasp|Q9S9V0|CDPKV_ARATH Calcium-dependent protein kinase 3139.700%Swiss-ProtMedium
Q93VK0Arabidopsis thalianasp|Q93VK0|PPCK2_ARATH Phosphoenolpyruvate carboxylase kinase 234.500%Swiss-ProtMedium
B9FKW9Oryza sativa subsp. japonicasp|B9FKW9|CDPKE_ORYSJ Calcium-dependent protein kinase 1439.900%Swiss-ProtMedium

JBrowse

View in Genome Browser