TkA01G399820 | RubberDandelionOmics

Gene overview

TkA01G399820

Reference: TK1151 Chr: Chr01 Coordinates: 99788350-99790497 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2059 bp · TkA01G399820|TK1151|cDNA

TTTTTATCCCAAGGGCCTCAATTTTTATTCCCCGGCCCCATGTTGACTTCGGCCGGTGTCTGCAATATATATGTATATAACGCAGCATCTGATACATCAAACACCTATCTGCAATCAATATGTATTCCAGTAATATGGGCATGGATAGCCACGACATGATGGACATCGACGGTTGGAGACCTCGGATAGCTCTTTCCATGTCCTACAATAGCGGTAGTCAACCACCGTCCATTGGAGATGTGAGGCAAATCGACGTTTCT...

CDS

Download CDS FASTA

1650 bp · TkA01G399820|TK1151|CDS

ATGTATTCCAGTAATATGGGCATGGATAGCCACGACATGATGGACATCGACGGTTGGAGACCTCGGATAGCTCTTTCCATGTCCTACAATAGCGGTAGTCAACCACCGTCCATTGGAGATGTGAGGCAAATCGACGTTTCTGAACCTTCCTTCGGTATTCCGATGGATAGTGATGGACAGTCACCGTCGGTTAACGACGTCGGTAGAAGAGAACCATCTCAAAGTGAGGCATCGTTCACCTGGTATGAGGGTCCTGATGC...

Protein

Download Protein FASTA

549 aa · TkA01G399820|TK1151|PROTEIN

MYSSNMGMDSHDMMDIDGWRPRIALSMSYNSGSQPPSIGDVRQIDVSEPSFGIPMDSDGQSPSVNDVGRREPSQSEASFTWYEGPDALEVQQHNLELQLACDGSLVNSSYEEERSSKQSAVSVEEVELSDIFDKIVSVTDACEAPPTQKLLQNGQQSHRYTSGWIDRSEGGNSGEPTDFRPLLVNCAQSIATDEYITANEQLKQIRQHASPSGDAPQRLAHLFATGLEARLAGIGSHKTSMRISAAEKLQAYQTYLSASP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G399820`
TK1151 ID	TkA01G399820
OH-1004 ID	LXL04_000580
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.400
Protein coverage (%)	TK1151 80.692 / OH-1004 67.786 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G399820

Location Chr01:99788350-99790497 (+)

Description Similar to SCL14: Scarecrow-like protein 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07530`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At2g29065`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At1g07520`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At2g29060`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At3g46600`	Probable transcription factor involved in plant development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000580 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0080183 response to photooxidative stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G07520

ath:AT1G07530

ath:AT2G29060

ath:AT2G29065

ath:AT2G37650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.654

Rank 1 · TkA01G399820 · TK1151

Cytoplasm0.434

Rank 2 · TkA01G399820 · TK1151

Cell membrane0.045

Rank 3 · TkA01G399820 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA01G399820 · TK1151

Plastid0.029

Rank 5 · TkA01G399820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514GRAS181-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G399820	`PF03514`	GRAS	181	546	1.5e-102	344.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XE58`	Arabidopsis thaliana	sp\|Q9XE58\|SCL14_ARATH Scarecrow-like protein 14	51.300%	Swiss-Prot	High
`P0C884`	Arabidopsis thaliana	sp\|P0C884\|SCL34_ARATH Scarecrow-like protein 34	52.100%	Swiss-Prot	High
`Q3EDH0`	Arabidopsis thaliana	sp\|Q3EDH0\|SCL31_ARATH Scarecrow-like protein 31	50.700%	Swiss-Prot	High
`P0C883`	Arabidopsis thaliana	sp\|P0C883\|SCL33_ARATH Scarecrow-like protein 33	51.800%	Swiss-Prot	High
`Q9SNB8`	Arabidopsis thaliana	sp\|Q9SNB8\|SCL30_ARATH Scarecrow-like protein 30	46.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card