TkA01G383760 | RubberDandelionOmics

Gene overview

TkA01G383760

Reference: TK1151 Chr: Chr01 Coordinates: 95787109-95789310 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1041 bp · TkA01G383760|TK1151|cDNA

ATGACGCCCTTCCCTAAAAGTTCCGCCACAAGTTTCTTTTTGATTCACACCACCGACGGCATGAACAAATCCGACATGAGAAAGGCATCAAAACATGAAGACGGGGCTGATTTGATCAGCAACTTGCCAGATCACATCCTTCTTTTGATTCTCTCGGGACTTCCATCTACCGAAGAAATAATCCGAACAAGCATTTTGTCCAGACGATGGAGGTATTTGTGGACTTCAATTCCCTCTCTAGACTTGGTATATCCCCGAGA...

CDS

Download CDS FASTA

1041 bp · TkA01G383760|TK1151|CDS

ATGACGCCCTTCCCTAAAAGTTCCGCCACAAGTTTCTTTTTGATTCACACCACCGACGGCATGAACAAATCCGACATGAGAAAGGCATCAAAACATGAAGACGGGGCTGATTTGATCAGCAACTTGCCAGATCACATCCTTCTTTTGATTCTCTCGGGACTTCCATCTACCGAAGAAATAATCCGAACAAGCATTTTGTCCAGACGATGGAGGTATTTGTGGACTTCAATTCCCTCTCTAGACTTGGTATATCCCCGAGA...

Protein

Download Protein FASTA

346 aa · TkA01G383760|TK1151|PROTEIN

MTPFPKSSATSFFLIHTTDGMNKSDMRKASKHEDGADLISNLPDHILLLILSGLPSTEEIIRTSILSRRWRYLWTSIPSLDLVYPRERKPSGKSNYSKFKEFVDWVLLNRSADLDSFRVSHSLYYSMSTIERWIHAAVMRNVKQLDLVFPSNWKSEDMAMPVCASLEVLRVIQRINGDSVKDFLESCPMLEDLTLDNCRLDKLDRLTPIRRCETSTSVAVFTLHVVYRRRCETSVAVSFVLTREAVARSGIWKEEIAGRF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G383760`
TK1151 ID	TkA01G383760
OH-1004 ID	LXL04_003232
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.133 / OH-1004 75.885 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G383760

Location Chr01:95787109-95789310 (-)

Description Similar to KLCR1: Protein KINESIN LIGHT CHAIN-RELATED 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10840`	Protein KINESIN LIGHT CHAIN-RELATED 1.	No verified direct reference in this release
`At1g78760`	Putative F-box/FBD/LRR-repeat protein At1g78760.	No verified direct reference in this release
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At4g14103`	F-box/LRR-repeat protein At4g14103.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003232 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

KEGG gene cross-reference

ath:AT1G27500

ath:AT3G28410

ath:AT4G10840

ath:AT5G02700

ath:AT5G03100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.668

Rank 1 · TkA01G383760 · TK1151

Cytoplasm0.315

Rank 2 · TkA01G383760 · TK1151

Cell membrane0.066

Rank 3 · TkA01G383760 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA01G383760 · TK1151

Mitochondrion0.035

Rank 5 · TkA01G383760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box39-78 aa

PF12937F-box-like39-73 aa

PF23622LRR_At1g61320_AtMIF140-73 aa

PF23622LRR_At1g61320_AtMIF1120-152 aa

PF24758LRR_At5g56370131-202 aa

PF23622LRR_At1g61320_AtMIF1163-199 aa

PF13374TPR_10167-178 aa

PF00515TPR_1283-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G383760	`PF00646`	F-box	39	78	1.7e-07	31.6
TkA01G383760	`PF12937`	F-box-like	39	73	9.4e-06	26.0
TkA01G383760	`PF23622`	LRR_At1g61320_AtMIF1	40	73	0.0058	16.8
TkA01G383760	`PF23622`	LRR_At1g61320_AtMIF1	120	152	0.0058	16.8
TkA01G383760	`PF24758`	LRR_At5g56370	131	202	0.0057	17.1
TkA01G383760	`PF23622`	LRR_At1g61320_AtMIF1	163	199	0.0058	16.8
TkA01G383760	`PF13374`	TPR_10	167	178	0.025	15.3
TkA01G383760	`PF00515`	TPR_1	283	310	0.0011	19.4
TkA01G383760	`PF07719`	TPR_2	283	311	0.002	18.8
TkA01G383760	`PF13181`	TPR_8	283	310	0.0029	18.4
TkA01G383760	`PF13424`	TPR_12	284	323	0.0033	18.3
TkA01G383760	`PF13374`	TPR_10	284	320	0.025	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81629`	Arabidopsis thaliana	sp\|O81629\|KLCR1_ARATH Protein KINESIN LIGHT CHAIN-RELATED 1	67.100%	Swiss-Prot	Low
`Q9ZV94`	Arabidopsis thaliana	sp\|Q9ZV94\|FDL11_ARATH Putative F-box/FBD/LRR-repeat protein At1g78760	27.700%	Swiss-Prot	Low
`Q9FWZ1`	Arabidopsis thaliana	sp\|Q9FWZ1\|FBL13_ARATH F-box/LRR-repeat protein 13	28.000%	Swiss-Prot	Low
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	31.400%	Swiss-Prot	Medium
`Q8L7H1`	Arabidopsis thaliana	sp\|Q8L7H1\|FBL75_ARATH F-box/LRR-repeat protein At4g14103	33.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card