TkA01G383670 | RubberDandelionOmics

Gene overview

TkA01G383670

Reference: TK1151 Chr: Chr01 Coordinates: 95754221-95756332 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1681 bp · TkA01G383670|TK1151|cDNA

AAAATACTTATCATTCTCATTTACTTCGACCGGCCGAAAGACGCCCCTCAACTTTAGGGTTTTTTTGCTCTTTCCCGCCAAAAGCTACTCCCTTTCACTTTATGTAGAAGCTCCGGGATAGATCGGTTCTGTCTTTTCTTTTCGACTCACAACACAGAAGGCATGAACAAATCCGGCCGGACAAAGCCATCAGAACATGAAGATGGGGTTGATTTGATCAGCAACTTGCCAGATCCTATTCTTCATTTGATTCTCTCGCG...

CDS

Download CDS FASTA

1251 bp · TkA01G383670|TK1151|CDS

ATGAACAAATCCGGCCGGACAAAGCCATCAGAACATGAAGATGGGGTTGATTTGATCAGCAACTTGCCAGATCCTATTCTTCATTTGATTCTCTCGCGTGTTCCATCTTCCGAAGAAATAACCCGAACGAGCATTTTGTCCAGACGATGGAGGTATGTGTGGACTTCAGGTCCCTCTCTAGACTTGCGATATGGCGCCTCAGACGATTCAAAAATAAGCCAGTTCAAAGAATTTGTTGATCGAGTTTTGTTAAACAGATC...

Protein

Download Protein FASTA

416 aa · TkA01G383670|TK1151|PROTEIN

MNKSGRTKPSEHEDGVDLISNLPDPILHLILSRVPSSEEITRTSILSRRWRYVWTSGPSLDLRYGASDDSKISQFKEFVDRVLLNRSVDLDRLRLSCSDYYSRSTVERWIHATVMRNIKQLELSFSPKEESENLVIPDCLVTCASLEVLKLDSRDRGLILLKHMGFPALRVLYLGYIELFDSDSVEDFLESCPVLEDLTLDQVILHEKIDFLCISCPKLKKLRFSSHYKGCLMISSPELMCLAVTAYVATDIICEGLSSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G383670`
TK1151 ID	TkA01G383670
OH-1004 ID	LXL04_003234
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 91.630 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G383670

Location Chr01:95754221-95756332 (-)

Description Similar to At4g10400: FBD-associated F-box protein At4g10400

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56370`	FBD-associated F-box protein At5g56370.	No verified direct reference in this release
`At4g15060`	Putative F-box/LRR-repeat protein At4g15060.	No verified direct reference in this release
`At4g14103`	F-box/LRR-repeat protein At4g14103.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003234 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G66310

ath:AT4G10400

ath:AT4G14103

ath:AT5G02700

ath:AT5G56370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.789

Rank 1 · TkA01G383670 · TK1151

Cytoplasm0.221

Rank 2 · TkA01G383670 · TK1151

Cell membrane0.063

Rank 3 · TkA01G383670 · TK1151

Endoplasmic reticulum0.049

Rank 4 · TkA01G383670 · TK1151

Plastid0.022

Rank 5 · TkA01G383670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box19-56 aa

PF12937F-box-like19-53 aa

PF29594LRR_SKP283-147 aa

PF23622LRR_At1g61320_AtMIF189-348 aa

PF12937F-box-like89-100 aa

PF00646F-box91-97 aa

PF07723LRR_293-107 aa

PF24758LRR_At5g56370106-202 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G383670	`PF00646`	F-box	19	56	1.1e-06	29.1
TkA01G383670	`PF12937`	F-box-like	19	53	0.00062	20.2
TkA01G383670	`PF29594`	LRR_SKP2	83	147	0.023	14.7
TkA01G383670	`PF23622`	LRR_At1g61320_AtMIF1	89	348	3.5e-09	37.2
TkA01G383670	`PF12937`	F-box-like	89	100	0.00062	20.2
TkA01G383670	`PF00646`	F-box	91	97	1.1e-06	29.1
TkA01G383670	`PF07723`	LRR_2	93	107	5.2e-05	24.4
TkA01G383670	`PF24758`	LRR_At5g56370	106	202	3.5e-20	73.3
TkA01G383670	`PF07723`	LRR_2	145	153	5.2e-05	24.4
TkA01G383670	`PF07723`	LRR_2	169	193	5.2e-05	24.4
TkA01G383670	`PF29594`	LRR_SKP2	182	239	0.023	14.7
TkA01G383670	`PF24758`	LRR_At5g56370	198	265	3.5e-20	73.3
TkA01G383670	`PF24758`	LRR_At5g56370	279	342	3.5e-20	73.3
TkA01G383670	`PF29594`	LRR_SKP2	294	337	0.023	14.7
TkA01G383670	`PF07723`	LRR_2	307	332	5.2e-05	24.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FM94`	Arabidopsis thaliana	sp\|Q9FM94\|FBD21_ARATH FBD-associated F-box protein At5g56370	29.900%	Swiss-Prot	Low
`O23360`	Arabidopsis thaliana	sp\|O23360\|FBL93_ARATH Putative F-box/LRR-repeat protein At4g15060	26.800%	Swiss-Prot	Low
`Q8L7H1`	Arabidopsis thaliana	sp\|Q8L7H1\|FBL75_ARATH F-box/LRR-repeat protein At4g14103	33.000%	Swiss-Prot	Medium
`Q9FM89`	Arabidopsis thaliana	sp\|Q9FM89\|FDL38_ARATH F-box/FBD/LRR-repeat protein At5g56420	29.300%	Swiss-Prot	Low
`Q9LXR6`	Arabidopsis thaliana	sp\|Q9LXR6\|FB207_ARATH Putative F-box protein At3g58860	29.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card