TkA01G358330 | RubberDandelionOmics

Gene overview

TkA01G358330

Reference: TK1151 Chr: Chr01 Coordinates: 89029587-89031908 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1171 bp · TkA01G358330|TK1151|cDNA

AAAACAAAAAACAAAAGGAATGGCACACGGTGGCTACGACAAGCGGCGGGTCGCCGGACGGAAACCGGTGAACAAAGCTACCAATCACCGTCCAAAAGCGTTGGGTGTGGAGAAGAAACCTAAAGCCAAGCTCGTCTCTCTCAAGCGCCAAATTCGTTCTACGGAGCGTTTGCTTCGCAAGGACACGAGGCCTGAAGTGAAAGAAGCCCTAACAAAGAAATTAGAAGGATTGAAGAATCAACAGCAGCTCATGGATAATC...

CDS

Download CDS FASTA

1059 bp · TkA01G358330|TK1151|CDS

ATGGCACACGGTGGCTACGACAAGCGGCGGGTCGCCGGACGGAAACCGGTGAACAAAGCTACCAATCACCGTCCAAAAGCGTTGGGTGTGGAGAAGAAACCTAAAGCCAAGCTCGTCTCTCTCAAGCGCCAAATTCGTTCTACGGAGCGTTTGCTTCGCAAGGACACGAGGCCTGAAGTGAAAGAAGCCCTAACAAAGAAATTAGAAGGATTGAAGAATCAACAGCAGCTCATGGATAATCTAGCTTTGGAACGCAAAAT...

Protein

Download Protein FASTA

352 aa · TkA01G358330|TK1151|PROTEIN

MAHGGYDKRRVAGRKPVNKATNHRPKALGVEKKPKAKLVSLKRQIRSTERLLRKDTRPEVKEALTKKLEGLKNQQQLMDNLALERKIFLRDRKIKFFERRKVERRIRRLEKQQRASSGQAQETEVADQLSKLKEDLEYIRFFPKTEKYVSLFKKGDNTETLDKRNNLRTQIKANIAAAVASGKDLEETGSEEDGLDLSEDDFFLSGSSSDEADADDEWTDKSAREQASSASGKAASGMSSDERNQRHISARALMPPPRSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G358330`
TK1151 ID	TkA01G358330
OH-1004 ID	LXL04_003449
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G358330`
Location	Chr01:89029587-89031908 (-)
Description	Similar to efg1: rRNA-processing protein efg1 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003449` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000321 re-entry into mitotic cell cycle after pheromone arrest Biological Process GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0071027 nuclear RNA surveillance Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0030688 preribosome, small subunit precursor Cellular Component
KEGG gene cross-reference	ago:AGOS_ABR143C cci:CC1G_04573 cgr:2888404 pgu:PGUG_03034 spo:2543142 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.942

Rank 1 · TkA01G358330 · TK1151

Cytoplasm0.149

Rank 2 · TkA01G358330 · TK1151

Mitochondrion0.018

Rank 3 · TkA01G358330 · TK1151

Cell membrane0.014

Rank 4 · TkA01G358330 · TK1151

Extracellular0.009

Rank 5 · TkA01G358330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10153Efg141-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G358330	`PF10153`	Efg1	41	152	1.2e-27	97.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card