TkA01G320990 | RubberDandelionOmics

Gene overview

TkA01G320990

Reference: TK1151 Chr: Chr01 Coordinates: 79731197-79732493 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1194 bp · TkA01G320990|TK1151|cDNA

ATGAATATGTATAACACAGCTTGCAAAGAAGCAGTCACAGCGAAAAAGCAGGTAAAAAAATTTGAGCAGGCCCGTCTCGCTGAAGAAGCAGCGCTTGCGCTGATAGAGACGGAGAAAGCAAAATGCAGAGCCGCCATTGAGGCAGCAGAGAAAGCACAGAAAATAGCTGAGAAGGAAATACAGAGAAGAAGGCATGCAGAGATGAAGTTAAAGAGAGAAGCAGAAGAAAAGAATAGAGCATTGGATGTGTTGTCAAACAA...

CDS

Download CDS FASTA

1194 bp · TkA01G320990|TK1151|CDS

ATGAATATGTATAACACAGCTTGCAAAGAAGCAGTCACAGCGAAAAAGCAGGTAAAAAAATTTGAGCAGGCCCGTCTCGCTGAAGAAGCAGCGCTTGCGCTGATAGAGACGGAGAAAGCAAAATGCAGAGCCGCCATTGAGGCAGCAGAGAAAGCACAGAAAATAGCTGAGAAGGAAATACAGAGAAGAAGGCATGCAGAGATGAAGTTAAAGAGAGAAGCAGAAGAAAAGAATAGAGCATTGGATGTGTTGTCAAACAA...

Protein

Download Protein FASTA

397 aa · TkA01G320990|TK1151|PROTEIN

MNMYNTACKEAVTAKKQVKKFEQARLAEEAALALIETEKAKCRAAIEAAEKAQKIAEKEIQRRRHAEMKLKREAEEKNRALDVLSNNDDRCRKYTINEIEAATDNFSRSMKIGEGGYGPVFKGTLDHTAVAIKVLRPDAAQGRKQFQQEVEVLTCMRHPNMVLLMGACPEYGCLVYEFMDNGSLEDRLYRKGNTPPIPWGIRFKIAADIATGLLFLHQAKPEPLVHRDLKPANILLDHHYTCKISDVGLARLVPPSVANT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G320990`
TK1151 ID	TkA01G320990
OH-1004 ID	LXL04_022120
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	64.300
Protein coverage (%)	TK1151 98.237 / OH-1004 51.053 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G320990

Location Chr01:79731197-79732493 (+)

Description Similar to PUB35: U-box domain-containing protein 35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19410`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g61550`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At4g25160`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g61560`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g51270`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022120 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19410

ath:AT4G25160

ath:AT5G61550

ath:AT5G61560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.583

Rank 1 · TkA01G320990 · TK1151

Cytoplasm0.382

Rank 2 · TkA01G320990 · TK1151

Nucleus0.259

Rank 3 · TkA01G320990 · TK1151

Golgi apparatus0.042

Rank 4 · TkA01G320990 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkA01G320990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09989DUF222913-73 aa

PF01636APH43-79 aa

PF03109ABC147-85 aa

PF00069Pkinase49-71 aa

PF00069Pkinase107-358 aa

PF07714PK_Tyr_Ser-Thr109-359 aa

PF03109ABC1118-141 aa

PF03109ABC1214-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G320990	`PF09989`	DUF2229	13	73	6.1	7.2
TkA01G320990	`PF01636`	APH	43	79	0.57	10.6
TkA01G320990	`PF03109`	ABC1	47	85	0.00098	19.1
TkA01G320990	`PF00069`	Pkinase	49	71	3.1e-40	139.0
TkA01G320990	`PF00069`	Pkinase	107	358	3.1e-40	139.0
TkA01G320990	`PF07714`	PK_Tyr_Ser-Thr	109	359	1.6e-39	136.5
TkA01G320990	`PF03109`	ABC1	118	141	0.00098	19.1
TkA01G320990	`PF03109`	ABC1	214	262	0.00098	19.1
TkA01G320990	`PF01636`	APH	217	237	0.57	10.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8S7`	Arabidopsis thaliana	sp\|Q8S8S7\|PUB34_ARATH U-box domain-containing protein 34	49.300%	Swiss-Prot	Medium
`Q9FKG6`	Arabidopsis thaliana	sp\|Q9FKG6\|PUB52_ARATH U-box domain-containing protein 52	50.300%	Swiss-Prot	High
`Q9SW11`	Arabidopsis thaliana	sp\|Q9SW11\|PUB35_ARATH U-box domain-containing protein 35	51.800%	Swiss-Prot	High
`Q9FKG5`	Arabidopsis thaliana	sp\|Q9FKG5\|PUB51_ARATH U-box domain-containing protein 51	44.300%	Swiss-Prot	Medium
`Q9LU47`	Arabidopsis thaliana	sp\|Q9LU47\|PUB53_ARATH Putative U-box domain-containing protein 53	49.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card