RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G320700
Reference: TK1151 Chr: Chr01 Coordinates: 79607033-79611256 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2007 bp · TkA01G320700|TK1151|cDNA

ATGCAAAATTCTACGAAATCTCCTTCTAAAAGGAGTACAATTGAGAAGCAAATGGACAAAATAATATACATCCTTTTCAGTCTTCTGGTGCTTATATCATTCATGAGTTCTGTTGGTTTCATGGTGAAGACTAAAAATGATTTGCCAAATTGGTGGTATTTACGGGTTCCGGATAGTGGAAATCTCTATAATCCCAACAAACCACTAGAGTCAGCGTTTTATCATCTCATTACTGCTCTTATGTTGTACGGATATTTGAT...

CDS

Download CDS FASTA

2007 bp · TkA01G320700|TK1151|CDS

ATGCAAAATTCTACGAAATCTCCTTCTAAAAGGAGTACAATTGAGAAGCAAATGGACAAAATAATATACATCCTTTTCAGTCTTCTGGTGCTTATATCATTCATGAGTTCTGTTGGTTTCATGGTGAAGACTAAAAATGATTTGCCAAATTGGTGGTATTTACGGGTTCCGGATAGTGGAAATCTCTATAATCCCAACAAACCACTAGAGTCAGCGTTTTATCATCTCATTACTGCTCTTATGTTGTACGGATATTTGAT...

Protein

Download Protein FASTA

668 aa · TkA01G320700|TK1151|PROTEIN

MQNSTKSPSKRSTIEKQMDKIIYILFSLLVLISFMSSVGFMVKTKNDLPNWWYLRVPDSGNLYNPNKPLESAFYHLITALMLYGYLIPISLYVSIEVVKVLQALFINKDIHMYDEETGTPAQARTSNLNEELGQVNTILSDKTGTLTCNQMDFLKCSIAGTAYGTSPSDVELAAAEQMVMDLDDRSRREFFRTEIQLETVVTSKDDIVKSPIKGFSFEDSRLMTGNWFKEPNVDDILLFFRILSVCHSAIPEQNEETGAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G320700
TK1151 IDTkA01G320700
OH-1004 IDLXL04_008258
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)76.400
Protein coverage (%)TK1151 99.102 / OH-1004 49.698
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G320700
LocationChr01:79607033-79611256 (+)
DescriptionSimilar to ALA4: Probable phospholipid-transporting ATPase 4
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g17500 Involved in transport of phospholipids. No verified direct reference in this release
At1g54280 Involved in transport of phospholipids and in regulation of pollen plasma membrane lipid asymmetry.
Loss of the Arabidopsis thaliana P4-ATPases ALA6 and ALA7 impairs pollen fitness and alters the pollen tube plasma membrane.2015 · DOI: 10.3389/fpls.2015.00197
At3g13900 Involved in transport of phospholipids and in regulation of pollen plasma membrane lipid asymmetry.
Loss of the Arabidopsis thaliana P4-ATPases ALA6 and ALA7 impairs pollen fitness and alters the pollen tube plasma membrane.2015 · DOI: 10.3389/fpls.2015.00197
At1g72700 Involved in transport of phospholipids. No verified direct reference in this release
At1g68710 Involved in transport of phospholipids. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_008258 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009860 pollen tube growth Biological Process
GO:0010286 heat acclimation Biological Process
GO:0045332 phospholipid translocation Biological Process
GO:1901703 protein localization involved in auxin polar transport Biological Process
GO:1905038 regulation of membrane lipid metabolic process Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0012505 endomembrane system Cellular Component
GO:0000287 magnesium ion binding Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference
ath:AT1G17500
ath:AT1G54280
ath:AT1G72700
ath:AT3G13900
ath:AT3G25610
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.307
Rank 1 · TkA01G320700 · TK1151
Cytoplasm0.299
Rank 2 · TkA01G320700 · TK1151
Golgi apparatus0.286
Rank 3 · TkA01G320700 · TK1151
Endoplasmic reticulum0.261
Rank 4 · TkA01G320700 · TK1151
Lysosome / Vacuole0.150
Rank 5 · TkA01G320700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24487NDC80_loop113-146 aa
PF00702Hydrolase136-150 aa
PF13246Cation_ATPase240-434 aa
PF08282Hydrolase_3319-364 aa
PF24487NDC80_loop378-399 aa
PF00702Hydrolase390-462 aa
PF08282Hydrolase_3438-527 aa
PF24487NDC80_loop487-512 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G320700PF24487NDC80_loop1131460.5110.7
TkA01G320700PF00702Hydrolase1361502.1e-0835.5
TkA01G320700PF13246Cation_ATPase2404341.5e-2177.7
TkA01G320700PF08282Hydrolase_33193640.001419.1
TkA01G320700PF24487NDC80_loop3783990.5110.7
TkA01G320700PF00702Hydrolase3904622.1e-0835.5
TkA01G320700PF08282Hydrolase_34385270.001419.1
TkA01G320700PF24487NDC80_loop4875120.5110.7
TkA01G320700PF00702Hydrolase5715932.1e-0835.5
TkA01G320700PF08282Hydrolase_35765970.001419.1
TkA01G320700PF16212PhoLip_ATPase_C6076621.1e-2591.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LNQ4Arabidopsis thalianasp|Q9LNQ4|ALA4_ARATH Probable phospholipid-transporting ATPase 474.600%Swiss-ProtHigh
Q9SLK6Arabidopsis thalianasp|Q9SLK6|ALA6_ARATH Phospholipid-transporting ATPase 673.200%Swiss-ProtHigh
Q9LVK9Arabidopsis thalianasp|Q9LVK9|ALA7_ARATH Probable phospholipid-transporting ATPase 773.100%Swiss-ProtHigh
Q9SGG3Arabidopsis thalianasp|Q9SGG3|ALA5_ARATH Probable phospholipid-transporting ATPase 571.800%Swiss-ProtHigh
Q9SX33Arabidopsis thalianasp|Q9SX33|ALA9_ARATH Putative phospholipid-transporting ATPase 959.300%Swiss-ProtHigh

JBrowse

View in Genome Browser