RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G265510
Reference: TK1151 Chr: Chr01 Coordinates: 66681262-66687673 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3003 bp · TkA01G265510|TK1151|cDNA

TCCAGAGAAGAAGAAAAAACGACTTGGTCGTCCGAAGTTATGTGTCTCTTCAAAAGATGAAACAGTACCAACGAAGTAGTAAACAAGAAAGAGGACACAAAAGGAGAGTGGGAGACCCAAAAGAAGTACACAGGTTGATGGTTTTAGTTATGCGATTTTCGACCTTGATGTTGATGATGTTGAGGAGGATGTAGGGAAGAAGACAAAGCGGCCATTAACTTCAAAGAAAGAAAGGATTGGTGAAGAGGAACAAGATAAGA...

CDS

Download CDS FASTA

2280 bp · TkA01G265510|TK1151|CDS

ATGGTTCCAGATGAAAATGGAAATCTAGTTTATGTACAGTCAGAGATGTGCCATCAGTGCCAAAGGAATGACAAGGGAGATGTTGTTCGGTGCCAGAAATGCAAAACAAAGCGTTACTGTAAGGCTTGCATGGAAAACTGGTATCCTAATATGACAGAGGAGATGTTTGCTGAGTGTTGCCCTGTTTGCTTAGACAACTGCAACTGTAAAACTTGCTTGCGGGATGTGCACCCTAAAGTCAAACAGAAAATTGAATTTAT...

Protein

Download Protein FASTA

759 aa · TkA01G265510|TK1151|PROTEIN

MVPDENGNLVYVQSEMCHQCQRNDKGDVVRCQKCKTKRYCKACMENWYPNMTEEMFAECCPVCLDNCNCKTCLRDVHPKVKQKIEFIPSDDQKVGYSIYILHVLFPFLESLNEEHLKEKAIESKIQGCSSSEEVELKRAKCRKDERMYCNCCKTSIFDLHRSCTCCQYDLCLHCCWELRDGIPKGNEEDIVIDFNDPGLAYLHGGKEKEYKEARETRNIPKEKQTHEWKSLEDGRIPCPPKPIGGCDGGGFLELMRIKPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G265510
TK1151 IDTkA01G265510
OH-1004 IDLXL04_003825
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)92.800
Protein coverage (%)TK1151 99.341 / OH-1004 64.388
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G265510
LocationChr01:66681262-66687673 (-)
DescriptionSimilar to JMJ25: Lysine-specific demethylase JMJ25
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g07610 Histone demethylase that demethylates 'Lys-9' (H3K9me) of histone H3 with a specific activity for H3K9me2 and H3K9me1.
Control of genic DNA methylation by a jmjC domain-containing protein in Arabidopsis thaliana.2008 · DOI: 10.1126/science.1150987
An Arabidopsis jmjC domain protein protects transcribed genes from DNA methylation at CHG sites.2009 · DOI: 10.1038/emboj.2009.59
Autocatalytic differentiation of epigenetic modifications within the Arabidopsis genome.2010 · DOI: 10.1038/emboj.2010.227
DNA methylation in an intron of the IBM1 histone demethylase gene stabilizes chromatin modification patterns.2012 · DOI: 10.1038/emboj.2012.141
IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis.2012 · DOI: 10.1093/nar/gks647
SHOOT GROWTH1 maintains Arabidopsis epigenomes by regulating IBM1.2014 · DOI: 10.1371/journal.pone.0084687
Demethylation of ERECTA receptor genes by IBM1 histone demethylase affects stomatal development.2016 · DOI: 10.1242/dev.129932
Contrasting epigenetic control of transgenes and endogenous genes promotes post-transcriptional transgene silencing in Arabidopsis.2021 · DOI: 10.1038/s41467-021-22995-3
The arabidopsis GyraseB3 contributes to transposon silencing by promoting histone deacetylation.2025 · DOI: 10.1093/nar/gkaf985
At1g11950 May function as histone H3 lysine demethylase and be involved in regulation of gene expression. No verified direct reference in this release
At1g62310 May function as histone H3 lysine demethylase and be involved in regulation of gene expression. No verified direct reference in this release
At4g00990 Histone demethylase that demethylates 'Lys-9' (H3K9me) of histone H3 with a specific activity for H3K9me1 and H3K9me2.
JMJ27, an Arabidopsis H3K9 histone demethylase, modulates defense against Pseudomonas syringae and flowering time.2017 · DOI: 10.1111/tpj.13623
JMJ27-mediated histone H3K9 demethylation positively regulates drought-stress responses in Arabidopsis.2021 · DOI: 10.1111/nph.17593
At1g09060 May bind histone H3 but appears to lack demethylase activity because it cannot bind Fe²⁺.
JMJ24 binds to RDR2 and is required for the basal level transcription of silenced loci in Arabidopsis.2015 · DOI: 10.1111/tpj.12924
JMJ24 targets CHROMOMETHYLASE3 for proteasomal degradation in Arabidopsis.2016 · DOI: 10.1101/gad.274647.115
A JUMONJI Protein with E3 Ligase and Histone H3 Binding Activities Affects Transposon Silencing in Arabidopsis.2016 · DOI: 10.1104/pp.15.01688

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_003825 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006357 regulation of transcription by RNA polymerase II Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009555 pollen development Biological Process
GO:0009617 response to bacterium Biological Process
GO:0009908 flower development Biological Process
GO:0010440 stomatal lineage progression Biological Process
GO:0010468 regulation of gene expression Biological Process
GO:0040029 epigenetic regulation of gene expression Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0048366 leaf development Biological Process
GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process
KEGG gene cross-reference
ath:AT1G11950
ath:AT1G62310
ath:AT3G07610
ath:AT4G00990
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.594
Rank 1 · TkA01G265510 · TK1151
Cytoplasm0.342
Rank 2 · TkA01G265510 · TK1151
Cell membrane0.108
Rank 3 · TkA01G265510 · TK1151
Endoplasmic reticulum0.045
Rank 4 · TkA01G265510 · TK1151
Mitochondrion0.039
Rank 5 · TkA01G265510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08007JmjC_25-24 aa
PF02373JmjC6-21 aa
PF07883Cupin_27-25 aa
PF17765MLTR_LBD264-310 aa
PF13621Cupin_8331-374 aa
PF17765MLTR_LBD423-456 aa
PF13621Cupin_8482-499 aa
PF09507CDC27492-586 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G265510PF08007JmjC_25240.02414.9
TkA01G265510PF02373JmjC6213e-1454.2
TkA01G265510PF07883Cupin_27250.1312.7
TkA01G265510PF17765MLTR_LBD2643100.2112.3
TkA01G265510PF13621Cupin_83313740.02915.0
TkA01G265510PF17765MLTR_LBD4234560.2112.3
TkA01G265510PF13621Cupin_84824990.02915.0
TkA01G265510PF09507CDC274925860.01515.5
TkA01G265510PF02373JmjC5986953e-1454.2
TkA01G265510PF13621Cupin_86566900.02915.0
TkA01G265510PF08007JmjC_26636980.02414.9
TkA01G265510PF07883Cupin_26696860.1312.7
TkA01G265510PF17765MLTR_LBD7067460.2112.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SSE9Arabidopsis thalianasp|Q9SSE9|JMJ25_ARATH Lysine-specific demethylase JMJ2546.400%Swiss-ProtMedium
C0SUU8Arabidopsis thalianasp|C0SUU8|JMJ26_ARATH Lysine-specific demethylase JMJ2648.000%Swiss-ProtMedium
C0SV12Arabidopsis thalianasp|C0SV12|JMJ29_ARATH Lysine-specific demethylase JMJ2948.100%Swiss-ProtMedium
Q8VYB9Arabidopsis thalianasp|Q8VYB9|JMJ27_ARATH Lysine-specific demethylase JMJ2744.100%Swiss-ProtMedium
F4HZD1Arabidopsis thalianasp|F4HZD1|JMJ24_ARATH E3 ubiquitin-protein ligase JMJ2434.700%Swiss-ProtMedium

JBrowse

View in Genome Browser